Clone FMO10113 Report

Search the DGRC for FMO10113

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:13
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRad17-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10113.5prime Sequence

1163 bp (1023 high quality bases) assembled on 2010-11-05

> FMO10113.5prime
CAGTCGACATGAGCGTACGGAAGAAAACTTGGGTAAGATGTGCCTTCAGC
GAGATGAACTTGACCACCAGTCCTGCTCCTTCGGAATCCACGCCTGCGAA
GCGCACAAGAAGTGCAAGCAATGTGAGCAGCTCCAGAGTATCGAGGTCGA
GAACTCCAAGCATAAATACAAAGCCAATACAGATTCCGGACGTGGACTCA
GTCGATCTTACTGCCATGGATGATGACCAGGATGCGGACATCACTGTGCC
ACCGCCAGAAGTCAAAGAAAACTGGATGGAAAGCTTTGAGCCAGCCACCA
GCGACGATTTGGCGGTGCATCCAAAGAAGGTCGGAGAACTACGCGATTGG
CTGCGTCACTGCGAAGCGGTGCGCAAGAAGTTCCCGGCTCAAATGTGTCT
ACTTACCGGGCCCACTGGTGCTGGCAAAACCACCACGTTGCGAGTCCTGG
CCAAGGAGTTCGGCTACCAGCTGCAGGAGTGGATCAATCCTATCGATTGT
GAGGTGGTCAACACCTTGGGTGATCAAACGACTGGCGCCTCCTATGTGGG
CTCCCATCTGGAGGCCTTTAAAAGCTTTCTGCTCCGTGCCTCGCGATACA
AATCCTTGCTGGACTCGCAAAATAAGAGACTGCTTCTTGTCGAGGACTTT
CCCAACGTCCTGCTCAGCGATAAGGAGGTCAACTTTGAAGAGTTACTAGA
AGAGTACACGGCGTATGGCAAATCTCCCCTGGTGTTCATCGTTGCCGATG
CCAAATCTCGAGGATTGAATATCAGCTACCGCCTCTTTCCAGACCAACTG
AAGGCCAAACATCGCATCGAGCACATCAGTTTCAATGCTATTGCATCTAC
AATCATGCAAAAGTCAATGAAAACCTTCTGCTCCGTAATGCAGCAGAATA
AAGCTACTTACAAAGTGCCTCGACTGCTGTTGTGACTCAATAGTTGTCGG
TGCCCAGGGCGACATAAGAAATGCGTTAATTAATTTACATTTGAGCTCCT
TTAAAGGGAGTTCAGCCATGCCGACCAAACAGCTAATGTCATGTGGTTCC
GCAAGGTCGTTAGAAGAATAATGCAAGTACCTTTAAAGTCATTGTAAGAA
TGATCAATTACCTCTGATGCACGCACTGAAGAGAATAATCCTAGTTTATG
AGAGACAACATGT

FMO10113.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:45
Subject Length Description Subject Range Query Range Score Percent Strand
Rad17-RA 1823 CG7825-RA 49..1208 9..1158 5155 97.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:43
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 14662403..14663081 700..22 3395 100 Minus
3R 32079331 3R 14661979..14662316 1036..701 1425 96.2 Minus
Blast to na_te.dros performed on 2014-11-26 16:51:44 has no hits.

FMO10113.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:40 Download gff for FMO10113.5prime
Subject Subject Range Query Range Percent Splice Strand
Rad17-RA 44..1187 9..1143 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:37 Download gff for FMO10113.5prime
Subject Subject Range Query Range Percent Splice Strand
Rad17-RA 44..1187 9..1143 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:01 Download gff for FMO10113.5prime
Subject Subject Range Query Range Percent Splice Strand
Rad17-RA 49..1192 9..1143 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:01 Download gff for FMO10113.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 14662403..14663079 24..700 100 <- Minus
3R 14661865..14662316 701..1143 93 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:37 Download gff for FMO10113.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 10488125..10488801 24..700 100 <- Minus
arm_3R 10487587..10488038 701..1143 93 <- Minus