Clone FMO10114 Report

Search the DGRC for FMO10114

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:14
Vector:pMK33-CFH-BD
Associated Gene/Transcriptvari-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10114.5prime Sequence

1126 bp (1026 high quality bases) assembled on 2010-11-05

> FMO10114.5prime
CAGTCGACATGGTTCGGTGGAGCGCGCGGTCGCGGCGCCAAGCTCGCCAG
GATAAAGTGGAGCTATTGGCCAGAAACAACAAAGTGAATGGCGAGGACGA
TACCTCCGATAACGCCGCCTTTCGCAACTCGACTGACCTATCCGACCACG
ATGAGATCTTCCTCAAGGGATTGCTGCGTAGTAACTCCAACACGCCCCAC
AAGGAACTGATGCTGAATCCGACCGAGCCGCAGCCAGTGCCACTATTCCT
GCCCGCTCATCTGAACAACAAGCCCATCTGCGACGACATCATCCGCAAGT
TCTCACCCTCGAGGCGCCTGGAGTCGCGAGAACTCGCCAAGCTTCTCGCC
CAGCCGCATTTTCGTGCTCTTTTGCGCGCCCATGATGAGATAGGAGCACT
CTACGAGCAACGACTTAAAGCTGCCGGGGGATCCACCAGCCAACTAGAGA
TCGCCAGCCAACGCCAAACGGGAGGCTACCTGTTCACCGAGGACGTCCTC
AACACCAAGATGCCAGTGGAGACCATCAAGATGGTGGGTCTGCGCCGAGA
TCCCAGCAAGCCGCTGGGCCTGACCGTCGAACTGGACGAATTCAAGCAGC
TGGTCGTGGCCAGGATTCTGGCGGGCGGGGTGATCGACAAACAGAGCATG
CTGCACGTTGGCGATGTCATCCTAGAGGTGAACGGTACGCCCGTTCGCAC
TCCCGATGAGCTGCAGGTGGAGGTGTCGCGGGCCAAGGAGAATCTCACCC
TCAAGATCGGGCCGAACGTGGACGAGGAGATCAAGAGCGGTCGCTATACT
TGCTACATGCGTGCCCTTTTCACATACAATCCATCCGAAGATTCCTTGCT
GCCATGCAGGATATTGGATTGCCCTTCAAGTCGGGCGACATTTTGCAGAT
CATCAACGTAAAGGATCCCAACTGGTGCAGCCCAGACATTACTGCCGAAT
CTGACAAATTGGACTCATACCATCCCAGAGCTGGAGGAGCGGCGCCAAGG
CCTTCGTGGCCCGAGGCGACTACGTTCACAAGATTGCATTTGCGAACAAG
AATTCTCCGAACGAAAGCGCAGACATGTACGATCTGTGGCCATTGCCGAG
TCGACAAGGCGGAACCTGCTTGCTCT

FMO10114.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:49
Subject Length Description Subject Range Query Range Score Percent Strand
vari-RD 2717 CG9326-RD 285..1402 9..1113 5050 97.9 Plus
vari-RE 2535 CG9326-RE 285..1076 9..800 3945 99.9 Plus
vari-RB 2610 CG9326-RB 285..1076 9..800 3945 99.9 Plus
vari-RE 2535 CG9326-RE 1140..1465 801..1113 1105 93 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:47
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 20791230..20791664 800..366 2175 100 Minus
2L 23513712 2L 20792113..20792267 366..212 760 99.4 Minus
2L 23513712 2L 20796653..20796758 114..9 530 100 Minus
2L 23513712 2L 20796037..20796135 212..114 495 100 Minus
2L 23513712 2L 20790622..20790720 898..801 445 99 Minus
2L 23513712 2L 20790408..20790558 1036..893 335 92.1 Minus
Blast to na_te.dros performed on 2014-11-26 16:51:48 has no hits.

FMO10114.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:41 Download gff for FMO10114.5prime
Subject Subject Range Query Range Percent Splice Strand
vari-RD 275..1411 1..1126 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:39 Download gff for FMO10114.5prime
Subject Subject Range Query Range Percent Splice Strand
vari-RD 277..1413 1..1126 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:04 Download gff for FMO10114.5prime
Subject Subject Range Query Range Percent Splice Strand
vari-RD 277..1413 1..1126 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:04 Download gff for FMO10114.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 20796653..20796765 1..114 96   Minus
2L 20796037..20796134 115..212 100 <- Minus
2L 20792114..20792266 213..365 99 <- Minus
2L 20791230..20791664 366..800 100 <- Minus
2L 20790622..20790720 801..898 98 <- Minus
2L 20790391..20790552 899..1051 92 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:39 Download gff for FMO10114.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 20796653..20796765 1..114 96   Minus
arm_2L 20796037..20796134 115..212 100 <- Minus
arm_2L 20792114..20792266 213..365 99 <- Minus
arm_2L 20791230..20791664 366..800 100 <- Minus
arm_2L 20790622..20790720 801..898 98 <- Minus
arm_2L 20790391..20790552 899..1051 92 <- Minus