Clone FMO10115 Report

Search the DGRC for FMO10115

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:15
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG9795-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10115.5prime Sequence

1141 bp (1024 high quality bases) assembled on 2010-11-05

> FMO10115.5prime
CAGTCGACATGAGCGTTTTGCGGGAGGAAACGACAACTTCCAGCCAGAGG
GAGATAAGCACAAACGGCGGTGGGTTGGATTTCCCCGCAGAAGTGACGTC
GCTGATTGCTGGCAACAGCTTTTGCTTAACGCCAGGAAATAACGGCGGGA
TCGGTGCCCAGAAAAAGGTCACTACTGGAGCGGGTCTGAACAGTACACAG
AGAGCTACGGATGCCACCAAGCGCAAGAAACTAAGGTCGCGTAACGTACC
ACCTTCCCCATTGGCCCAAAAAACTGAAGCAGCGGCGACCTCTCTTAACC
AAACGAACATCGGTGAGGTCAAGAGAACCGATATTAACTATTCCAACGAT
CACCTTGATGCCTGGTTGGAGAGCTGTTTACGTGATGCCACCAACGCCCA
ATTGTCTTCTTCATCTGAGTTTTTGGACTTCATACCGCCCACAGCACCAG
CTCATAAGCAAATGTTTTTGACTCAACAGCAGCAGCTGCCGCAGCTTAAA
CAGCAACTACAGCAGCAGAGGCAACAGGAATTTTCGAAGCGAACCCAGCC
TTACGGAGTGGGTCCAGGCACACCGTTTAGCCTGGGGATACAGCGCAATT
CGAACTCTCTTAGCCATCGATATCCGATGCTCTTCCCACCCCAGAGCCTT
AACAGCTATGGTGATGGTGGCCAGGAGTTTGCAAGCTTGCCTCCCCTGAA
CAACATGATGGGAGGGCCGGAAGGGCTTGGGTGCGATCAGGAACCGAATT
CGACGGATGTGCTGGATGGCAGCGAAAGCAATCCCAACTTTACCAAGGGA
TTTCGGTTCAGCGATCCGTGCCTACTGAACCCCTCCGATAATGACTCTAA
GCTGAGTGGCCAGAATACACCAGAGTGTCGAAATGTGAACAACATGGCAG
TGGCTGTGATCTGGCACATCAAAACAATTTTTCGCGGCTCTAATGGAACA
AATAAACATATGCACGAAACCAATTCAGATCTGCCGGAATTTGCATAATA
AAAAAGTTGATATCGAGCTTTAAAGCACCTCCCCTTATAGCCAGCACTGG
CAGGTGTTAGCTTGGGGGGCATGCGCACCGTAAGATAGCCTTAGCGGGCT
AAGCCACACAAGGTCCACCTCTTATTCTGCATGGGGATTGG

FMO10115.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:54
Subject Length Description Subject Range Query Range Score Percent Strand
CG9795-RF 2390 CG9795-RF 214..1342 7..1128 5240 98.1 Plus
CG9795-RE 2573 CG9795-RE 214..1342 7..1128 5240 98.1 Plus
CG9795-RD 2825 CG9795-RD 180..1308 7..1128 5240 98.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:50
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 4323229..4323622 203..596 1970 100 Plus
3R 32079331 3R 4323687..4323889 597..799 1015 100 Plus
3R 32079331 3R 4321850..4322047 7..204 990 100 Plus
3R 32079331 3R 4323952..4324164 799..1006 820 96.7 Plus
Blast to na_te.dros performed 2014-11-26 16:51:52
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6761..6849 442..529 181 68.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6869..6922 474..527 171 79.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6740..6848 442..549 155 61.5 Plus
roo 9092 roo DM_ROO 9092bp 1124..1184 474..535 155 76.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2362 474..529 154 75 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2343..2399 474..530 150 73.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6806..6911 439..540 150 64.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6773..6858 439..526 147 64.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2364..2420 474..530 141 71.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6731..6787 474..530 141 71.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6752..6808 474..530 141 71.9 Plus
roo 9092 roo DM_ROO 9092bp 1079..1135 474..530 141 71.9 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3291..3364 474..547 136 64.9 Plus
Dmer\R1A3 3772 Dmer\R1A3 MERCR1A3 3772bp 639..715 551..475 133 63.6 Minus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2820..2870 474..527 128 74.1 Plus
Dmer\R1A3 3772 Dmer\R1A3 MERCR1A3 3772bp 672..726 527..473 122 69.1 Minus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2322..2374 474..526 121 69.8 Plus
roo 9092 roo DM_ROO 9092bp 1079..1162 439..527 118 62.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2763..2856 433..525 116 59.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2790..2832 474..516 116 74.4 Plus

FMO10115.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:41 Download gff for FMO10115.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9795-RC 202..1349 1..1141 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:41 Download gff for FMO10115.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9795-RD 175..1322 1..1141 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:06 Download gff for FMO10115.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9795-RD 175..1322 1..1141 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:06 Download gff for FMO10115.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 4323953..4324164 800..1006 96 -> Plus
3R 4323687..4323889 597..799 100 -> Plus
3R 4323231..4323622 205..596 100 -> Plus
3R 4321845..4322047 1..204 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:41 Download gff for FMO10115.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 149675..149886 800..1006 96 -> Plus
arm_3R 149409..149611 597..799 100 -> Plus
arm_3R 148953..149344 205..596 100 -> Plus
arm_3R 147567..147769 1..204 98 -> Plus