Clone FMO10117 Report

Search the DGRC for FMO10117

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:17
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPask-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10117.5prime Sequence

1171 bp (1043 high quality bases) assembled on 2010-11-05

> FMO10117.5prime
CAGTCGACATGGAGGATCAGGGCGACGTGACAGACCAAGCCGCTGGTAAG
CTGAGTAGTTCGAATGCCCAGTGCTCCAGAAACCGATGTGCTAATGATGA
CCCCATTATGGGCAGCCACAGTCAGAGTCGCCAGAACTCGTCCGGCATGC
TGAACATGATGGACGCCAGCTCCTTCAGCATGCCCCCCCCCAATCTGCAC
TCCTCAAAGGTGATCAACCCGAACAAGGCGATATTCACAATCGACGCGAA
CACAGGGCAAATTTTTATAGTGAACAACAAGGCCTGCCAGCTGCTGGGCT
ACACGTCGCAGGAGTTGAGGAACAAGGGATTCTTCGACCTGCTTAACGGC
AAGACAGAGAGCCACATCTCCTCCCTGGCGGAGATGCAGATCGAAGGCGA
TGAGGGCCGGGTCGTCCTGCTAAGTGGAAAGGTCATCGAGATGAAGACCA
AGTCGGGCGGCAAGATCCTGGTCTCTCTCTGGATCCGGCAGATCAGCAGC
GATGGCCGACACATAGCCGTCGCGGAGCCTGTGGAGAGGCATATTTGCCA
CATCAGCACCGATAGATCCGGAGTGATAACATCCGTTGACTCCACCACGG
CCACCATATTCTTTTATGAATCCGTCGAAAGCGTGGTGGGTGTCAGCATT
GTCACCCTTATCCCGTTTATAAAGCTGCCCGATCCGGATAGCCGTGAGAT
CCCCAAGAGCCTGCGGAAGCAGAGAGCTACTGGTCGAACTACGGATAACG
TAAAGTTTCCCCTGTGCTTGCTAATAGCCCTGGACGAGGATGCTTCTGCG
GGGGTATTCCCATTCGGGAAAAACCGGTCTAAATATCACCGTCTGGGTGT
TCCAGAATCTTAGTGGCCTGATTGTGGTAGATGACATAGGCAACATACTG
ATGTGCAACCAGCCTTTCTCGCTGCTAATGTTCGGATATGGTCAGGACAG
ATATGAACATGCATTTATCGGCGATCTACCCAATTTCGGCAAGGACTCTC
GCGAGGAGAGAGTCCGAATGTTTCGAACACCTCCGAATACCAGTTACGAC
TGGGAGCGGAACCGGATCCCCCTCGTCGTTGACAACGACTCCTCGCTGCC
ATCTGGCAAGAAGGTCTCGACTTAACGGACGGTCCTCTAACATCGATCGG
CTTCGGTGGGCGATGCCCACC

FMO10117.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:57
Subject Length Description Subject Range Query Range Score Percent Strand
Pask-RA 3184 CG3105-RA 94..1258 9..1171 5280 97.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:55
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 23988986..23990063 96..1171 4620 96.5 Plus
2R 25286936 2R 23988831..23988918 9..96 440 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:51:56 has no hits.

FMO10117.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:42 Download gff for FMO10117.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3105-RA 115..1207 9..1099 98 == Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:43 Download gff for FMO10117.5prime
Subject Subject Range Query Range Percent Splice Strand
Pask-RA 94..1186 9..1099 98 == Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:08 Download gff for FMO10117.5prime
Subject Subject Range Query Range Percent Splice Strand
Pask-RA 94..1186 9..1099 98 == Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:08 Download gff for FMO10117.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 23988987..23989991 97..1099 98 == Plus
2R 23988831..23988918 9..96 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:43 Download gff for FMO10117.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 19876510..19877514 97..1099 98 == Plus
arm_2R 19876354..19876441 9..96 100 -> Plus