Clone FMO10121 Report

Search the DGRC for FMO10121

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:21
Vector:pMK33-CFH-BD
Associated Gene/TranscriptVAChT-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10121.5prime Sequence

1149 bp (1046 high quality bases) assembled on 2010-11-05

> FMO10121.5prime
CAGTCGACATGGCCTCATTCCAAATACCTGTTATCAACCTGGAGGTGCGC
GAGGTCAAGGACATCGTGTGGGAGAAGATCCAGGAGCCGGTGAACCAGCG
ACGCCTCATCCTCGTGATTGTATCGATAGCCCTGCTGCTGGACAACATGC
TGTATATGGTGATAGTACCGATTATACCCGACTATTTAAGAGAGATTGGC
AGCTTCGATGACGGGCCGACGCCTCCACCGTTGAGGGATAATATCACGGG
AAAGATCATACCCGTGCATCATGATCATCACGGGCAGGACTCGGCCACGG
GCATCCTATTCGCCTCGAAGGCCATCGTCCAGCTGATGGTGAATCCGTTT
TCGGGCGGCCTCATCGACAAGATCGGCTACGATTTGCCCATGATGATCGG
CCTGACCATCATGTTCTTCTCGACGGCAGTCTTTGCTTGTGGCAGCAGCT
ACAGTGTCCTGTTCTTCGCCCGATCCCTGCAGGGAGCCGGTTCCGCCTTT
GCGGACACCGCCGGTTTGGCCATGATAGCCGATCGGTTCACCGAGGAGAA
CGAACGTTCGCAGGCCCTTGGCATTGCGTTGGCCTTCATCAGTTTCGGAT
GCCTGGTGGCGCCTCCGTTTGGCGGAGCGCTCTACCAGTTCGCCGGAAAG
GAAGTGCCCTTTCTGATCCTGGCACTGGTGTGCCTACTGGACGGGCTGAT
GCTGCTGCTGGTGATGAAACCGGTCAAGGAGGCGATGAAGCAAAGCAAGG
ATGTGCAGGACCAAGTAATACCCATCTGGCGCCTGCTGATGGATCCCTAT
ATTGCAGTCTGTGCCGGGGCACTGACCATGTCCAATGTGGCGCTGGCCTT
TCTGGAGCCAACCATTTCGCTGTGGATGGAGGATAACATGACCACTGACA
CTGGAAGATCGGCATGGTCTGGCTGCCCGCCTTCTTCCCACACGTGCTGG
GCGGGTCATTACGGTGAAGATGGCCCGCAAGTATCCGCAGCACCCAGGTG
GCTAATGGCTGCCGGTGGATTGACCCTGGAGGGCTCTCCTGCTTCATCAT
ACCATCTGCAACGGCTACAAAATGCTCATGCCTGCCATCTGGTGTGATCT
GCTCCGAATGCCTAATAGAACCCGTTACTACCCAACCTCGTATCCTGGG

FMO10121.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:07
Subject Length Description Subject Range Query Range Score Percent Strand
VAChT-RA 7098 CG32848-RA 992..2106 9..1119 5235 98.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:05
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 18712810..18713905 9..1103 5075 98.7 Plus
Blast to na_te.dros performed 2014-11-26 16:52:06
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6770..6826 716..660 114 66.7 Minus

FMO10121.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:44 Download gff for FMO10121.5prime
Subject Subject Range Query Range Percent Splice Strand
VAChT-RA 1033..2155 1..1119 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:50 Download gff for FMO10121.5prime
Subject Subject Range Query Range Percent Splice Strand
VAChT-RA 1033..2155 1..1119 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:14 Download gff for FMO10121.5prime
Subject Subject Range Query Range Percent Splice Strand
VAChT-RA 984..2106 1..1119 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:14 Download gff for FMO10121.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 18712802..18713924 1..1119 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:50 Download gff for FMO10121.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 14538524..14539646 1..1119 98   Plus