Clone FMO10122 Report

Search the DGRC for FMO10122

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:22
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG12402-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10122.5prime Sequence

1178 bp (1080 high quality bases) assembled on 2010-11-05

> FMO10122.5prime
CAGTCGACATGGGGAATAGTCTGATAACGAGTGGAAAACCGAGTCAGCGC
CGTGAAAAGAGGCTTTTCGAGAGGCTGAGCTGCAGCTACGCTCAGACCCC
CAACAGAATGGAGTTGAACTTGAATCCCCTGCTGGCCATCGCCCGTTCCA
TTGCGGCGCCACCGACACCGCCTCCAACCCCGGAAAAGTTGGACTCGGAT
AAGGATAAGGAGGGTTCCTCCAAAGCCGCCATCGAACTGCTGCCTAACGA
GATGTGGCTAGAGATCATGTCCTACCTTTCGTACAATGACCTGCTGCAAT
TGCGGATGGTGTCCTGGCGGTGCCGTGATCTGGTTCATCGTCGTCGATTC
ATGGAGAAAGGGAAGGTGATAGTGACGCAACACAACCTGGAGGCGATCCA
CAAGCATGCGAAGGGCGGAAATTGCTATTTGAGCTTCGAGCGGATTGAAT
TAAGAAATCTACGCCAGTGCCGCCAGTTGGAGAACTTTCTGCGTCTTGTG
GGCCACGAAGTGAAGCATCTGCAAGTGCGCCATGCTCCTGTTTTCCGGAA
TCTGGATGGCAAGTTACCAAACCTTAAGGTTCTGACCATTGCCACGACTA
TGTCGATGGATGACCAGCATCTGGCGGCGATGGATGACCTGGATATGAAG
CAGTTTTCCCACCTTGTGGGATTCGAATGCGATGGCGTGAGTTTGGACGC
GGTGCTTAAGATGCGAATGTTGTTGCAGCTGCGACGAACGGAGAACAAGT
GCAACTGCGGCACCTGCAATTCGAATTCCGGCGGAACAACGAAAATGCTC
TGCTGGATGTCCTACAGGATCATGCGGAAACCTTGGTGTGCGTCAATTTA
TTCTTCAGCTGCTCGCCGGGCATTGATACGCGTGAATGGTGCCGAGCGTT
CGAAATATGCACAATCTGCGAACTCTCAAGCTTTCGGGAAATTGTCATCT
GGTCCTGTTGGAAGCTGTCCTAAGAGCCGTTCCGGAGTCAGCACATCCGT
CACTGGATTTGACCGGAATGTTATCGCTAACCAACGAATTACTGCTCTAA
TGTAGCTGGCAAGGTGCCAAGCACTCTTGAAAGTGCTCGATCTTATGGTT
TGTGGTCAACTCACGCCATGCCATGATGCACTGGCCCAACCTGAAATGTC
GGTTGAGACTTGAACATGGCTTACGACA

FMO10122.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG12402-RC 3476 CG12402-RC 506..1679 8..1174 5295 97.3 Plus
CG12402-RB 3476 CG12402-RB 506..1679 8..1174 5295 97.3 Plus
CG12402-RA 3476 CG12402-RA 506..1679 8..1174 5295 97.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:36
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 14106413..14107435 1113..94 4690 98.5 Minus
3R 32079331 3R 14107729..14107816 95..8 440 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:51:37 has no hits.

FMO10122.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:39 Download gff for FMO10122.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12402-RA 1..1108 9..1113 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:32 Download gff for FMO10122.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12402-RA 503..1614 1..1113 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:38:58 Download gff for FMO10122.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12402-RA 503..1614 1..1113 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:38:58 Download gff for FMO10122.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 14107729..14107819 1..95 95   Minus
3R 14106401..14107433 96..1123 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:32 Download gff for FMO10122.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 9933451..9933541 1..95 95   Minus
arm_3R 9932123..9933155 96..1123 98 <- Minus