Clone FMO10123 Report

Search the DGRC for FMO10123

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:23
Vector:pMK33-CFH-BD
Associated Gene/TranscriptTdc2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10123.5prime Sequence

1136 bp (1005 high quality bases) assembled on 2010-11-05

> FMO10123.5prime
CAGTCGACATGGACAGCACCGAATTTCGAAAACGTGGCATGGAAATGGTG
GAGTACATCTGCAACTATCTGGAAACGCTGAACGAGCGACGGGTCACGCC
CAGCGTGGAGCCGGGATATTTGAGACACCTGTTGCCACCTGAGGCACCGC
AGGAGCCGGAGGACTGGGACCAGATCATGAGGGACGTGGAGGACAAGATC
ATGCCCGGCGTGACGCATTGGCAGCATCCTCGCTTCCACGCCTATTTTCC
GGCGGGCAACTCGTTCCCCTCTATCCTGGGCGACATGTTGGGCGACGGGA
TCGGGTGCATCGGCTTCTCCTGGGCCGCCAGTCCCGCGTGCACCGAGCTG
GAGACCATAGTGCTCGACTGGCTTGGCAAGGCCATCGGTCTGCCGGACCA
CTTTCTGGCCCTCAAGGAGGGCAGCACCGGAGGGGGAGTCATCCAGACTT
CCGCATCGGAGTGCGTACTGGTCACGATGCTTGCTGCCAGGGCACAGGCG
CTCAAGAGGCTCAAGGCCCAGCACCCGTTTGTGGAGGAGGGTCACCTGCT
GTCCAAGCTTATGGCCTACTGCTCCAAGGAGGCGCACAGCTGCGTGGAGA
AAGCGGCGATGATCTGTTTCGTGAAGCTGCGCATTCTGGAGCCCGACGAC
GACGCCAGTCTGCGCGGCCAGACGATCTACGAGGCAATGGAGGAGGACGA
ACTGCAGGGTCTGGTGCCCTTCTTCGTCTCCACCACTCTGGGTACCACGG
GCTCGTGTGCGTTCGACAATCTGCCAGAGATCGGCAAGCAGTTGCAGCGA
TTCCCGGGCGTTTGGCTGCACGTGGATGCCGCCTACGCGGGCAACAGCTT
CATCTGCCCCGAGCTGAGCCGCTCCTGAAGGGCATCGAGTACGCCGACTC
GTTCACACCAATCTCAACAAATGGCTGCTGACGAACTTCGATTGCTCGAC
GCTGTGGGTGCGGGACCGCATCCGGCTGACTTCAGCCCTGTGGTGATCCG
CTGTACCTGTAGCACGGCTACTCGGATGCGGCCATCGATATTCGTCATGG
GGGAGTCCCTCAGTCGGCGGTTTCGTTCGCCTGGAGCTGGGTTCTGGCTG
CGATCCTATGGATCCAGCTGCACCATATATACGTCA

FMO10123.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:42
Subject Length Description Subject Range Query Range Score Percent Strand
Tdc2-RA 2303 CG30446-RA 163..1301 9..1136 5205 97.9 Plus
Tdc1-RA 2281 CG30445-RA 1012..1168 811..965 220 78 Plus
Hdc-RD 3733 CG3454-RD 920..1080 237..397 205 75.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:40
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 6687407..6687846 881..443 2150 99.8 Minus
2R 25286936 2R 6688003..6688310 446..139 1540 100 Minus
2R 25286936 2R 6687149..6687355 1080..879 700 93.7 Minus
2R 25286936 2R 6688373..6688502 138..9 650 100 Minus
2R 25286936 2R 10241871..10242031 237..397 205 75.2 Plus
Blast to na_te.dros performed on 2014-11-26 16:51:41 has no hits.

FMO10123.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:39 Download gff for FMO10123.5prime
Subject Subject Range Query Range Percent Splice Strand
Tdc2-RA 151..1259 9..1111 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:35 Download gff for FMO10123.5prime
Subject Subject Range Query Range Percent Splice Strand
Tdc2-RA 163..1271 9..1111 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:00 Download gff for FMO10123.5prime
Subject Subject Range Query Range Percent Splice Strand
Tdc2-RA 163..1271 9..1111 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:00 Download gff for FMO10123.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 6688373..6688502 9..138 100   Minus
2R 6688003..6688310 139..446 100 <- Minus
2R 6687408..6687842 447..880 99 <- Minus
2R 6687139..6687353 881..1090 93 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:35 Download gff for FMO10123.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 2575878..2576007 9..138 100   Minus
arm_2R 2575508..2575815 139..446 100 <- Minus
arm_2R 2574913..2575347 447..880 99 <- Minus
arm_2R 2574644..2574858 881..1090 93 <- Minus