Clone FMO10125 Report

Search the DGRC for FMO10125

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:25
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG12512-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10125.5prime Sequence

1126 bp (1022 high quality bases) assembled on 2010-11-05

> FMO10125.5prime
CAGTCGACATGAACAGCAAGCTGCAGACCATCTCCCGATACATGCTCAGG
CAGAAATGTGCCTTCAACTCGATGCGCAGCATTTCCACCTCGATGCCCAG
CTTGATCAGCCATAAGCATCATATTGGTAAGGATCCCTTGGTATATCGCA
CCATTGGCCAGCAGTTGGAGCTATCTGCTTCGAATTTTGGGGATGTGGAG
GCGATTGTCTCCTGTCACGAGGGCAAGCGGTACAGCTTCAAAAGTTTGCT
ACAGGAAGCGGATGCGCTGGCGGCGGGTTTCCGGAAATTGGGCCTGCAGC
CAGGTGATGCCGTTGGTCTGTGGGCACCTAACTACTTGCACTGGTACTTG
GGCATGATGGGAGCAGCTCGAGCGGGTCTCACCTCGGTGGGTTTGAATCC
AGCTTACCAGGGACCCGAAATAGCCTACTGTCTGAATAAGGTCAATGTGA
AGGCCATCATTGCGCCGGAGACCTTCAAGACGCAGAACTACTATGAGATT
TTGAGAGATATCTGCCCGGAAATCTCAGATGCGGATACTGGCAAGATCCG
GAGTGAGAAGTTTCCGCACCTGCGATCCGTAATCATTGATAGCAACGATA
GCCTGAAGGGTGCCCTGCGCTTCGATGACTTCCTGGACCTGGCCAGCAAA
TCGGAGCGCGAAGAGGTGGCCAAAATGCAGAAGAGCATTCTGCCCGAGTC
TGCGTGCAATATTCAGTTCACATCGGGAACCACTGGCAATCCCAAGGCTG
CCTGTCTTACCCATCACAATTTCGTCAACAATGGCATCCATGTGGGCAAT
CGCAACGAACTGGAGGGCGAGAGGATCTGTGTTCAGGTGCCCATGTTCCA
TGCCTTCGGTGTGATCATCTCCATCATGGCTGCTCTGACCAAAAGTGCCA
CCATGGTCCTACCCGCTGCTGGTTTCAGTCCCAAGGACTCGCTGCAAGCC
ATCGTCAATGAAAAGTTGTTCCGGTGATCCATGCACACCACCATTTTATG
TGGATTTGGTCACACGCAAAGAAGCTACAGGTGCCGCTTGGCCAGGATTA
GAAGCTGTCACGGAGGTGCCATTGTTTCGCCCGCAGCTGATCCAGGATGT
GAAACAGTTCTCACGTGGAGCGGTGC

FMO10125.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:12
Subject Length Description Subject Range Query Range Score Percent Strand
CG12512-RA 2054 CG12512-RA 180..1302 9..1126 5130 97.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:10
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 5339968..5341001 1107..76 4535 97.4 Minus
2L 23513712 2L 5341985..5342055 79..9 355 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:51:11 has no hits.

FMO10125.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:34 Download gff for FMO10125.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12512-RA 295..1417 9..1126 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:17 Download gff for FMO10125.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12512-RA 180..1302 9..1126 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:38:45 Download gff for FMO10125.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12512-RA 180..1302 9..1126 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:38:45 Download gff for FMO10125.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 5341985..5342055 9..79 100   Minus
2L 5339946..5340997 80..1126 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:17 Download gff for FMO10125.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 5341985..5342055 9..79 100   Minus
arm_2L 5339946..5340997 80..1126 97 <- Minus