Clone FMO10126 Report

Search the DGRC for FMO10126

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:26
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG9330-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10126.5prime Sequence

1100 bp (996 high quality bases) assembled on 2010-11-05

> FMO10126.5prime
CAGTCGACATGAGCGAGTACACAAGCATTCTGCAGCGCGAGTTTCCCAAA
ATCGACCACGAGCTGCTCACCTATGTCGTTGGCGTGCTCACCGGAAGCGA
GGAGGACTTCGAAAGCGGCGATGACATCTTCGAAGCGGTGGGCGACATCC
TGCAGAGCGTCGACTGTGATAGGTCGGAGGAGAGTGTACGTACGCTTTGC
GAGCAGTTCCTCAACATCATGAAGAACAACGAGGTCAACGTGGAGCGAAA
GGTTCTCAACGCGCCGGTCAACATCGAGGAGATGGCCAAGAACATGGAGC
GGCTGGACAAGGATATGCAAAGCATCTGGGTGGCCAACAAAGATGGCGCC
AATAAAGTGGACTCCAAGAAACTAGGAAAGGCGGAGGCCAAGCTGCAGCA
GAAGCAGGAGAAACGGCAGGAGGTGAACAAACATGGTATGATTCCTGTTG
CGGTGAAGCTACAAACGGCCACAGCCTCACAGGTGACCAACAAGAAGAAC
ACCAAGCTGGATCAGAAAGGTCTTAACCGATCCATGGACATCAAGATCGA
AAACTTTGACCTGGCTTTTGGCGAAAAAGTTCTTCTGCAGAATGCGAATC
TGCTGCTGTCTTACGGACGCCGCTATGGTCTGGTGGGACGCAATGGCCTG
GGCAAGACTACACTGCTCCGCATGATTGCCGAGCGACAGCTACAGATCCC
TTCGCACATATCGGTGCTGCACGTGGAGCAGGAGGTGGTTGGCGATGACA
CACCAGCAGTGGAGAGTGTGCTGGAATGTGATACTGAGCGAACGAGACTT
CTGACCCGCGAGAGGAGATTCTGGCTGCCCTTAACAATGGAGTTCATGAT
GCGACGCTGTCCAATGAGCTGAGCGAGACCTACGCCTCTCTGCAGAACAT
CGAGGCGGACAAGGCTGTGGCCCCGCATCTGTGATACTTAAGGCCTTGGG
ATTCGATGCAGTATATGCAGCTGCGTCCAACTAATTCTTTCTTCAAGCGG
CTGGGCCATGGCGTCTGCTTTTGGCCAGGGCACTGTTCCAAAACCGGATC
TGTTATCTGCTCGATTGAGCGACGAACATGTTTAGAATTCAAAGCATTAT

FMO10126.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:16
Subject Length Description Subject Range Query Range Score Percent Strand
CG9330-RA 2384 CG9330-RA 130..1220 9..1100 5015 97.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:13
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19587174..19587677 578..1082 1965 95.7 Plus
3L 28110227 3L 19586535..19586791 97..353 1285 100 Plus
3L 28110227 3L 19586892..19587115 354..577 1120 100 Plus
3L 28110227 3L 19586382..19586470 9..97 445 100 Plus
Blast to na_te.dros performed 2014-11-26 16:51:15
Subject Length Description Subject Range Query Range Score Percent Strand
roo 9092 roo DM_ROO 9092bp 1050..1101 383..433 113 71.2 Plus

FMO10126.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:34 Download gff for FMO10126.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9330-RA 118..1218 1..1100 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:19 Download gff for FMO10126.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9330-RA 120..1220 1..1100 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:38:47 Download gff for FMO10126.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9330-RA 120..1220 1..1100 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:38:47 Download gff for FMO10126.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19587174..19587695 578..1100 95   Plus
3L 19586892..19587115 354..577 100 -> Plus
3L 19586535..19586791 97..353 100 -> Plus
3L 19586372..19586469 1..96 95 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:19 Download gff for FMO10126.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19580274..19580795 578..1100 95   Plus
arm_3L 19579992..19580215 354..577 100 -> Plus
arm_3L 19579635..19579891 97..353 100 -> Plus
arm_3L 19579472..19579569 1..96 95 -> Plus