Clone FMO10127 Report

Search the DGRC for FMO10127

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:27
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG33696-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10127.5prime Sequence

1138 bp (1004 high quality bases) assembled on 2010-11-05

> FMO10127.5prime
CAGTCGACATGGATATGGAGTATATAACTAGCAGTAGTGGCAACATAACT
GCCACTACAGAAGCAGATTTCAGTTCATCTTTGGGCGAATCCAATGTCAC
GGAATACAATACAACGGAAATGGACGCGAATGAATCAGCTGGCGAGGATG
AGGAGATGCTAAGGATAGCCTTTTTTATAGGGCACTTCGTGCATCAATAC
TATATACCAGTGCTTTGCTGCACGGGCAGCATTGGCAATATCCTCTCCGT
GTTTGTCTTCTTTAGGACCAAGTTGAGAAAGTTGTCCTCCAGCTTTTACC
TGGCCGCTCTCGCAGTGAGCGACACCTGCTTCCTGGCCGGACTCTTCGCA
CAGTGGCTGAACTTCCTCAATGTGGATATCTATAATCAAAACTACTTTTG
CCAGTTCTTCACGTTCTTCAGCTACCTGGCCAGCTTCTGCTCCGTCTGGT
TTGTGGTGGCCTTCACCGTGGAGCGCTTCATTGCCGTCATCTATCCACTG
AAGCGCCAGACCATGTGCACCGTGCGCCGGGCCAAGATCGTCCTGTTTTG
TTTGACACTCGTGGGATGTCTGCACTGTCTGCCCTATATAGTCATTGCCA
AGCCGGTGTTTATGCCCAAATTGAACACGACCATTTGCGATCTCAACTCG
GAATACAAAGAACAACTGGCCCTCTTCAACTACTGGGACACCATAGTTGT
CTATGCGGTGCCCTTCACCACCATCGCCGTTCTGAACACCTGTACAGGTT
GTACGGTGTGGAAGTTCGCCACCGTTCGCCGAACGCTGACCATGCACAAG
ATGAAGCCCCAAACGAACAGCATGCCATCGTACTCGTCGAACTCATCGGG
CGGAGCCTCATCTGCAGTGGCCTCGTACCGCCTATCGGCATCGCTGAGCG
CCAGAAGTCGACGGAACGCATCCTAGTGGACAGCATATGTGGCCAACAGG
CAAGACGGATGATCAGGAGCAGCAAAGCAGTCCCAGCAGCATCAAAAAAC
AATTGCCAACACCATTGCGAGAATACGCCAAACCAGCCCGTTCGCAAGGT
GCAAACCTCATCGCAAGCTCAAGTAACCAAATGCCGTCCTAATTGTCCGA
CGGTTGTTTGCCTCAATTTGCAGTTGCTGCTGGGCATC

FMO10127.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:19
Subject Length Description Subject Range Query Range Score Percent Strand
CNMaR-RA 2704 CG33696-RA 727..1867 8..1138 5135 97.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:17
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 9644835..9645487 8..660 3265 100 Plus
3L 28110227 3L 9650980..9651209 803..1028 795 95.7 Plus
3L 28110227 3L 9650344..9650487 660..803 720 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:51:18 has no hits.

FMO10127.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:35 Download gff for FMO10127.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33696-RA 720..1861 1..1132 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:22 Download gff for FMO10127.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33696-RA 720..1861 1..1132 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:38:49 Download gff for FMO10127.5prime
Subject Subject Range Query Range Percent Splice Strand
CNMaR-RA 720..1861 1..1132 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:38:49 Download gff for FMO10127.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 9650980..9651218 803..1036 95 -> Plus
3L 9650344..9650486 660..802 100 -> Plus
3L 9644828..9645486 1..659 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:22 Download gff for FMO10127.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 9644080..9644318 803..1036 95 -> Plus
arm_3L 9643444..9643586 660..802 100 -> Plus
arm_3L 9637928..9638586 1..659 99 -> Plus