Clone FMO10130 Report

Search the DGRC for FMO10130

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:30
Vector:pMK33-CFH-BD
Associated Gene/TranscriptIrk2-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10130.5prime Sequence

1134 bp (1035 high quality bases) assembled on 2010-11-05

> FMO10130.5prime
CAGTCGACATGCAGGTCCCGCTCAGCGATGTTCAGGTCCTGCAGGATCCC
ACCGACGCGGAAACCCTTGTCGGCGGCGACAAGGAGGAGACCTTTGCCCA
CATGAAGGAGTGGAAGCGCCAGTACATGCGGGGCATCTCGCACACGCCAT
CGCAGGCGGGAGTCTACTACGAGGCCTTGAAGGGTTCCAGCCACTCGCTG
GCCAAAGGATCTCGCAATTTCCGGCCTGGCAGCATGAGACGTGTTCGCCG
ACGAGCGGTCTTCAAAAATGGTGACTGCAATGTGGTGCAGAAGCACCTGC
AAAGACGCCGAGTTCGTTTCCTGCAGGACATGTACACCACCATGGTGGAT
TGGCAGTGGCGGTGGACTCTCTTGGCCTTCGCACTCAGCTTTATCCTGTC
TTGGCTCTTCTTTGCTCTCATCTGGTGGCTGATTATCTACACACACGGAG
ACTTGGAAGAGCCTCACTTGCCAGAAAACCAAGAGGAATCTGGTTGGGCG
CCTTGTGTTTCGGCCATCGATGGCTTTACTTCCTGCTTCCTGTTCTCCAT
TGAAACGCAGCACACTATTGGCTACGGTGTCCGAACCACCTCGCCCGAGT
GTCCAGAGGCCATCTTCATGATGTGCTTCCAGTCCATCTATGGCGTGATG
TCTTCAGCATTTATGGCCGGAATAGTGTTTGCCAAGATGACAAGGGCCAA
ACAGCGGGCACAGACTTTGTTGTTCTCCAAACACGCCGTAATTTGCCAAC
GTGATGGCACCCTTTCGCTGATGTTCCGTGTGGGTGACATGCGAAAATCA
CACATCATTGGAGCCGGAGTGAGGGCTCAGTTGATCAGGACAAAGAGCAC
CAAGGAGGGTGAGGTGATGACACAGTACTTCACAGAACTGGAGATCGGTA
CTGATGACTCCGGCTCTGATTTGTTCTTCATCTGGCCCATGTCATCGAGC
ACAGATCGACGAGAACTCCACGCTCTATATCTAATGCCACTGAATATGCT
GCAGATAAGTTCGAAATCGTGGTGATCCTAAAGGGCACCGTGGGAGTCAA
CTGAACGAACACTCAGCCCGAATCAGCTTATATTAACTGAATCTTTGGGA
CATCGTCGAATCAATGGGTTGACACAGAATCGCA

FMO10130.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:25
Subject Length Description Subject Range Query Range Score Percent Strand
Irk2-RC 1485 CG4370-RC 50..1156 9..1106 5050 97.8 Plus
Irk2-RB 1600 CG4370-RB 50..1156 9..1106 5050 97.8 Plus
Irk2-RD 2248 CG4370-RD 543..1450 208..1106 4055 97.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:23
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23514596..23515161 1043..482 2495 98.1 Minus
3R 32079331 3R 23515213..23515488 483..208 1380 100 Minus
3R 32079331 3R 23518070..23518269 208..9 1000 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:51:24 has no hits.

FMO10130.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:36 Download gff for FMO10130.5prime
Subject Subject Range Query Range Percent Splice Strand
Irk2-RB 37..1105 1..1065 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:25 Download gff for FMO10130.5prime
Subject Subject Range Query Range Percent Splice Strand
Irk2-RB 42..1110 1..1065 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:38:52 Download gff for FMO10130.5prime
Subject Subject Range Query Range Percent Splice Strand
Irk2-RB 42..1110 1..1065 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:38:52 Download gff for FMO10130.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 23518070..23518275 1..208 98   Minus
3R 23515213..23515487 209..483 100 <- Minus
3R 23514574..23515159 484..1065 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:25 Download gff for FMO10130.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 19343792..19343997 1..208 98   Minus
arm_3R 19340935..19341209 209..483 100 <- Minus
arm_3R 19340296..19340881 484..1065 97 <- Minus