Clone FMO10132 Report

Search the DGRC for FMO10132

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:32
Vector:pMK33-CFH-BD
Associated Gene/TranscriptDhap-at-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10132.5prime Sequence

1140 bp (1015 high quality bases) assembled on 2010-11-05

> FMO10132.5prime
CAGTCGACATGGATAGAAATCCCGTGAGGCAGTCGACGTCATCCGGCACC
GTAGAAGGTGAATCCAGCGAACAGGAGGAGCAGAAGACGCCCAGTGCGGC
CGAATATATGAGGAACTTCAAGAACATCATAGCGCCGGGCAACGAGGCCT
CCATGACCAGGGAGTTCAATCCGCAGGTGGCATACGAATTCGAAAAGTAT
CTCAATCCGCAAAAGCTCAAGCAGCACGTCCTTAGGAGCGAGAAGCTGCG
ATCCATTCTGGAGCACTATGCCAAGGAGTCGGGCACGCCGCTCAAGCAGA
TGGAGCGTCAGGCCCGGGCGATCATTGATGAAATCGGCCTCGATCGGAAT
ATGGCCATCATCCGGTGGTGCGGCATTGCCATTACGGCGATCGGCAAGCG
GATCTGCGATGGATTCTATGTCAATTCGGCTAGCATGGCCAATGTGCGCA
AGGATATGGGCAAGTGCCCGGTGCTCTATCTGCCAAGTCATCGCAGCTAC
ATGGACTTCATCCTGATGTCCTACATCTGCTATTACTACGACATCGAGAT
ACCAGGAATAGCAGCCGGCATGGATTTCCACTCCATGTTCGGAATGGGCA
CCATGTTGAGGAAAACAGGAGCGTTCTTCATGCGCCGCAGCTTCTCCAAC
GATGAGCTATACTGGGATATTTTCCGGGAGTATATGTACGCGCTGGTGGC
AAACTACCACATCGGCGTGGAGTTCTTCATTGAGGGCACGCGCTCCAGGA
ATTTCAAAGCTCTGGTTCCCAAAATTGGACTACTCTCGATGGCTCTGTTG
CCATATTTCACGGGCGAAGTGCCGGATGTGATGATTGTGCCAGTGAGTGT
GGCCTACGAACGCGTCCTGAGGAGCAACTGTTCGTCTATGAGCTGCTGGG
TGTGCCCAAGCCCAAGGAGTCGACAATGGGCTTTTTCAAGGCCCTAAAAT
CATCGACGAGCGATTTGGCAAGATTGTTCCTCGACTTCGGAGAGCCCATC
TCGGTCAAGGAGTTTTCGACACGACAGCGCGCAACGAATGCAGCGAGCAG
GCGTGGGTGGTCACTTGCAAAGCTGAACCGCCAGGAGGTGAACTAGTCAA
AGCTGGCCCATGGAATTATTCTACAACGCACGTTCCATTG

FMO10132.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:21
Subject Length Description Subject Range Query Range Score Percent Strand
Dhap-at-RC 3516 CG4625-RC 356..1473 9..1119 5305 98.7 Plus
Dhap-at-RB 3441 CG4625-RB 281..1398 9..1119 5305 98.7 Plus
Dhap-at-RA 3516 CG4625-RA 356..1473 9..1119 5305 98.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:18
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 25488524..25489088 573..9 2825 100 Minus
3R 32079331 3R 25487739..25488272 1101..573 2315 98.1 Minus
Blast to na_te.dros performed on 2014-11-26 16:52:20 has no hits.

FMO10132.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:46 Download gff for FMO10132.5prime
Subject Subject Range Query Range Percent Splice Strand
Dhap-at-RA 1..1111 9..1112 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:56 Download gff for FMO10132.5prime
Subject Subject Range Query Range Percent Splice Strand
Dhap-at-RA 349..1466 1..1112 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:22 Download gff for FMO10132.5prime
Subject Subject Range Query Range Percent Splice Strand
Dhap-at-RA 349..1466 1..1112 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:22 Download gff for FMO10132.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 25488524..25489095 1..573 99   Minus
3R 25487724..25488271 574..1113 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:56 Download gff for FMO10132.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 21314246..21314817 1..573 99   Minus
arm_3R 21313446..21313993 574..1113 97 <- Minus