Clone FMO10135 Report

Search the DGRC for FMO10135

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:35
Vector:pMK33-CFH-BD
Associated Gene/Transcriptflr-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10135.5prime Sequence

1133 bp (1043 high quality bases) assembled on 2010-11-05

> FMO10135.5prime
CAGTCGACATGAGTCAACAGGCGAAAAACGAAAACATCTACGCAACTCTG
CCGCGCACCCAACGCGGCCAACCCATCGTTTTGGGTGCCGATCCCAAGGG
CAAGAACTTCCTGTACACCAATGGAAACTCTGTGATCATCCGGAACATCG
AGAATCCAGCCATTGCCGATGTCTACACGGAGCACTCGTGTGCAGTGAAC
GTGGCCAAGTACTCGCCCAGCGGATTTTATATTGCATCTGGTGACGCCTC
CGGCAAGATTCGCATTTGGGACACGGTCAACAAGGAGCACCTGCTTAAAA
ATGAGTTCCAGCCCATTGCAGGACCCATCAAGGATATTAGCTGGTCGCCA
GACAATCAGCGCATCGTTGCCGTGGGTGAAGGACGCGAACGTTTCGGTCA
TGTCTTTATGTCTGAAACCGGCACGTCTGTGGGCGAGATCAGTGGCCAGT
CCAAGTCTATTAACTCGGCGGACTTCCGGCCAGCCAGGCCATTCCGCATT
GTTACGGGCAGCGAAGACAATACTATCGCCGTGTTCGAGGGACCCCCGTT
CAAGTTCAAGATGACCAAGCAGGATCACTCTCGCTTCGTCCAGGCTGTGC
GCTACTCGCCCGATGGCAAATTCTTCGCCTCCGCCGGCTTTGATGGCAAA
GTCTTTCTGTACGATGGCACCAGCTCTGAACTGGTGGGCGAATTTGGATC
TCCTGCCCACAAGGGCGGCGTTTACGCATTGGCCTGGAAACCAGACAGCA
CCCAACTGCTAACCTGCTCCGGCGACAAGACGTGCCGCCTTTGGACAGTG
GAGTCGCGCGAGCTGGTTAGCGAGTTTGTGATGGGCACCACTGTGGACGA
CCAGCAGTGTCCTGCTTGTGGCAAGGAGACAACCTAATCACCGTCTCGCT
TTCGGGCGTGATCACCTACCTCAATGTGCGGATCCCTCGAAACCGCTGCG
TGTGTGAAGGGCCACAATAGCCCATCACCGTGCTGGGACTGACGATGACC
GCAGCACCATATACACGGGTAGCCACGATGGCGTGGTGACCACTGACTCG
GCACGGACCACGATCGCATCCGGGTCACTTGAACCGGACGAATCACGCAT
GGCCGCCTGGGGGTGACTTGCCTATCTGGGATC

FMO10135.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:11
Subject Length Description Subject Range Query Range Score Percent Strand
flr-RB 2210 CG10724-RB 47..1173 9..1119 5090 97.8 Plus
flr-RA 2275 CG10724-RA 128..1238 25..1119 4995 97.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:09
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 13414660..13415205 502..1042 2465 98.9 Plus
3L 28110227 3L 13414336..13414601 243..508 1330 100 Plus
3L 28110227 3L 13413316..13413438 30..152 615 100 Plus
3L 28110227 3L 13414056..13414148 151..243 465 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:52:10 has no hits.

FMO10135.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:44 Download gff for FMO10135.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10724-RB 41..1104 2..1056 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:52 Download gff for FMO10135.5prime
Subject Subject Range Query Range Percent Splice Strand
flr-RB 41..1104 2..1056 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:16 Download gff for FMO10135.5prime
Subject Subject Range Query Range Percent Splice Strand
flr-RB 41..1104 2..1056 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:16 Download gff for FMO10135.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 13414666..13415224 508..1056 98   Plus
3L 13414337..13414600 244..507 100 -> Plus
3L 13414058..13414148 153..243 100 -> Plus
3L 13413317..13413438 31..152 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:52 Download gff for FMO10135.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 13407766..13408324 508..1056 98   Plus
arm_3L 13407437..13407700 244..507 100 -> Plus
arm_3L 13407158..13407248 153..243 100 -> Plus
arm_3L 13406417..13406538 31..152 100 -> Plus