Clone FMO10136 Report

Search the DGRC for FMO10136

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:36
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG32473-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10136.5prime Sequence

1160 bp (1036 high quality bases) assembled on 2010-11-05

> FMO10136.5prime
CAGTCGACATGGCAACTGTGGCGCCCGCTGTAAAAGCCGCGAGCAAGGTG
CTCCAGAATCTGGGATTCCGGCTGCCCAAACAGATTAAGCCAAGCAAGTA
CCGCCTTCATTTGCGCCCCGATCTCGAACGAAAGAACTATTCCGGCAATA
TAAGCATCAGCCTGCAAGTACTGGAGCCCATAGCCTTCATCCCAGTCCAT
GTGAAGCAACTGAATGTGAGCACCGTTGAGGTGAAGCGCCTGGATGAATC
TGGAGCGCCGCTTAAGGACATCACCCCCACGCTGACCTTTGCCCATCCGG
AGTTTGAGTACTGGGTGACCGAGTTCGAACAGCCGCTGGAGGCGGGAAAC
TACTCACTGCTGCTCAACTTTACGGGATCGCTTGTAGATCGGATTACGGG
GATGTACCAGAGCTCCTACTTGGATAAGCTGAAAAACCGCTCCAGATCAA
TCATTTCCACAAAGTTTGAGCCCACTTATGCCCGCCAAGCATTCCCCTGC
TTCGATGAGCCCGCCCTTAAGGCTCAGTTCACCATAACGGTGGCCCGTCC
AAGTGGTGATGAGTACCATGTGCTGTCCAACATGCCAGTGGCCAGCGAGT
ATGTCGATGGCGATATCACCGAGGTGACTTTCGCGGAGACCGTACCCATG
AGCACCTATCTGGCCGCCTTTGTGGTGTCTGATTTTCAATACAAGGAAAC
CACTGTGGAGGGAACCAGCATCGCTCTGAAAGTCTATGCGCCACCAGCGC
AGGTGGAGAAAACCCAGTACGCCCTGGACACTGCGGCCGGAGTGATGGCC
TACTACATCAACTATTTCAATGTTTCGTATGCCCTACCCAAATTGGATCT
GGTTGCCATACCCGATTTCGTGTCCGGTGCTATGGAAAACTGGGGATTGG
TCACGTTCCGGGAGACTCTCTTCTGTACGACGAATCTACCAGTTCCAGCG
TGAATAAGCAGCGTGTGGCCATCGTCGTGCCCATGAGTTGCTCCCCAGTG
GTTCCGAAACCTGGTAACATGAACTGGTGAACGATTTGTGGCTAACAGAG
GGTTTCGCATCATTCTTTGAATACAGGGAGTAAGCCATTGCATCGATGGA
AATGACATCAGCTGTTTATGAAGACTGCACCGGGGGCTTGACACATTGGT
GCACCCTTAA

FMO10136.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG32473-RB 3002 CG32473-RB 134..1226 9..1094 5155 98.5 Plus
CG32473-RC 3635 CG32473-RC 767..1859 9..1094 5155 98.5 Plus
CG32473-RA 3273 CG32473-RA 840..1497 444..1094 2980 97.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:12
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 13310143..13310780 443..1075 2835 98.1 Plus
3R 32079331 3R 13309519..13309955 9..445 2185 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:52:13 has no hits.

FMO10136.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:45 Download gff for FMO10136.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32473-RB 130..1214 1..1083 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:53 Download gff for FMO10136.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32473-RC 763..1847 1..1083 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:19 Download gff for FMO10136.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32473-RC 763..1847 1..1083 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:19 Download gff for FMO10136.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 13310146..13310798 446..1091 97 <- Plus
3R 13309515..13309955 1..445 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:53 Download gff for FMO10136.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 9135868..9136520 446..1091 97 <- Plus
arm_3R 9135237..9135677 1..445 99 -> Plus