Clone FMO10137 Report

Search the DGRC for FMO10137

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:37
Vector:pMK33-CFH-BD
Associated Gene/Transcriptvlc-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10137.5prime Sequence

1132 bp (997 high quality bases) assembled on 2010-11-05

> FMO10137.5prime
CAGTCGACATGGATCGCAGTCTGGACTCTATTGGCAGCTGTTCACTGGAT
GTAGACGCCGACTCCTCCGATATATCAGATACCAGTGGGAGCCTGAACTT
TCCAACGCCGGTCTCAGTAAGGGACATAACACGCGAATTTACTGCCAACC
TTCGGGAGCGCTGTGTGCCTAACTTGCCTCCCCAGCCTCAGCACAAAACC
CCTGCCTACGTTGAATCCAGGTCGTCAGAGCTGGAGCACATGGTGCTGTC
ACCTGCAATTGTGGAGTGCGACCAAGAGCCGAGCTCCAATGATTTTGACG
AGACTTCTGCAGAAAATTCACAAGAAGCTCCCGAAAAGAAGCCCAGCTAT
TTAAACCTGGCTTGCTGCGTCAACGGTTATTCCAACCTTACCACCTACGA
CTCCAAGATTCGGCAGGACATAAACAAGTCACCGACACCAACTCTGCACA
GCATGCCTTCTCCGGCCACCAAGTGCAAACCCATCGAGCCTAACAACAAC
AGCAACGACAGTAGCGGGAATTTTAGTTCGGGTTCTGGTCACAGCAATGG
AAATGGCAGTTTTATCAAGCAACGGGTGGAGCGACTTTACGGGCCGGGTG
CATTAGCCCAGGGTTTCTACAGCCCCAAAAAGCACGGCCAGTCACCATCG
AATGCTGCAGGGCGATCGGAAAGGGGGCAGGTGGAGATCGACTCTCTACA
AGGCTCCGAACTGGCTCGGAAATTCAAGCAGCTCTCCCCCAGTAAAGACT
ATGGGGAGTTTCGAAAAAAAATGCAGAAGAAGTGTTCTCAGAGTACAACG
GCGAGGATAGACGAGCCGTTGCATTCTCCAGGGCTTAACGGAGATCTTGA
CCTGCCCGTGTTTAGGCACCTTAGTCAAGAGTTCCGCGCCCAGTTGCCTA
CTGTGTCACCAAAAAGGGGTGCTTCCCGATCTGCATGGCTCCTGATGTAC
TGCTTGTAGATAACGAGTCAAGTCCAGACCCATGTTCCCACAGATGAAGT
GACCACGAATTCACCAAAATGGACAACCTAGCCTCCGAGAGAATACATCA
GCACTCCAAATTTTCGGTGGAGGCGTGTTGTTAAGAATGAATCCTTCCGG
AAAAAACTTAAAAGGACAAGCGTCCTGGTGCT

FMO10137.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:41
Subject Length Description Subject Range Query Range Score Percent Strand
vlc-RB 2388 CG8390-RB 116..1197 8..1089 5080 98.2 Plus
vlc-RI 2425 CG8390-RI 578..1234 433..1089 2955 97.1 Plus
vlc-RH 2369 CG8390-RH 522..1178 433..1089 2955 97.1 Plus
vlc-RI 2425 CG8390-RI 87..511 8..432 2125 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:39
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 5703471..5704093 433..1055 2820 98.2 Plus
2R 25286936 2R 5703048..5703404 76..432 1785 100 Plus
2R 25286936 2R 5702877..5702947 8..78 355 100 Plus
Blast to na_te.dros performed 2014-11-26 16:52:40
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 5601..5673 443..515 122 63 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2324..2420 418..520 111 65.7 Plus

FMO10137.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:49 Download gff for FMO10137.5prime
Subject Subject Range Query Range Percent Splice Strand
vlc-RB 112..1183 1..1071 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:06 Download gff for FMO10137.5prime
Subject Subject Range Query Range Percent Splice Strand
vlc-RB 109..1180 1..1071 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:31 Download gff for FMO10137.5prime
Subject Subject Range Query Range Percent Splice Strand
vlc-RB 109..1180 1..1071 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:31 Download gff for FMO10137.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 5703471..5704110 433..1071 97   Plus
2R 5703051..5703404 79..432 100 -> Plus
2R 5702870..5702947 1..78 96 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:06 Download gff for FMO10137.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 1590976..1591615 433..1071 97   Plus
arm_2R 1590556..1590909 79..432 100 -> Plus
arm_2R 1590375..1590452 1..78 96 -> Plus