Clone FMO10139 Report

Search the DGRC for FMO10139

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:39
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRgl-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10139.5prime Sequence

1114 bp (987 high quality bases) assembled on 2010-11-05

> FMO10139.5prime
CAGTCGACATGAGTCAAAATGTGGCCGACAGTTTGCCCACGTGGCGCCTT
TGGGGCGAAGAGCACGAGAAGAATGCAATTTTCACCGTTTACCTGAAGAA
AGTGCGATACCACCGACCGACGCCCACAGCCAGCAATGACTCAGATGATG
AGATTTCCCATCTGGAGTGGGAGACTGTACGCGTGCGTTTCGTTAAGGCG
GCTACATTGGCTCGATTGGTGGAGGCGTTAGCCACCGACGACGGCGAGCT
GGAGTCCACCTTCATCAACGTGTTCCTGTCCACATATCGCACCTTCTCCA
CACCCAAGCAGGTGCTCAGTCTGCTGACGCAACGGTACGATGCTCTGCAT
GAGAAGCACCTGGAGGAGTTGGAGCAGGCACAGCAAAATGGACAGGTCAT
GGATCCCGCCTACGATCCACACGCCTCCATTCACGAGCAGCACAAGAAAA
CCCTAGTCTCAGCGCTGCACGTCTGGCTGGATGGATTCCCGGAGGATTGG
CACGAGGATAACCTGCAACAGATCTTGGCATTTGCCACCAAGCGGCTGAA
ACGATCCGATCTGCACATCAAGGTGCTGAATCGTCTGGAACGGCTCATCA
AACAGTCTCTCTATGGAAATGGAGGAGGAAGCGGTGGCTCGGAGAACAAT
GGTCATTCGTGGCTTTCCGCAGCGCGCTCACAACAGATGCAGCAATTCAT
GATTCCCACTCACTATGGCTCTTCGTATGACCTCACGGATCAGTTCAATG
GCATGTACCTCTCGCCAATGGGCCACGGGCCCATCTATCGTGCACCTACC
CACTTTCTGCAGGCATTCCGTTTTCCGCATGTGCCCGTCCGGCATTTTGC
TGAGCAGTTGACCCGTATGGATACGGAACTCTTTAAGCGACTGATTCCCC
ACCAGTGCCTCGGACACACGTGGGCACGACGTGATAGTGGAGGATCCGAG
ACTGTGGTGGCCACCATCAACCAGTTTATGCATGCTCTCCGGTGGTGTCC
AGTATCCTGATCGATCGCCCTGAACCTCAGAGCGCGCCTTCTGAACATTT
CACGATGGATGAATGCCAAGAGAGTTGCCATGCCTCAAACTTAGTTCGCT
CAAGGCATCATTCC

FMO10139.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:50
Subject Length Description Subject Range Query Range Score Percent Strand
Rgl-RC 3754 CG8865-RC 503..1615 9..1112 5110 98.1 Plus
Rgl-RD 3865 CG8865-RD 614..1726 9..1112 5110 98.1 Plus
Rgl-RB 3939 CG8865-RB 688..1800 9..1112 5110 98.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:48
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 13909256..13909772 1030..518 2345 98.3 Minus
3L 28110227 3L 13909832..13910215 521..138 1920 100 Minus
3L 28110227 3L 13910483..13910586 138..35 520 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:52:49 has no hits.

FMO10139.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:50 Download gff for FMO10139.5prime
Subject Subject Range Query Range Percent Splice Strand
Rgl-RC 494..1617 1..1114 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:10 Download gff for FMO10139.5prime
Subject Subject Range Query Range Percent Splice Strand
Rgl-RB 679..1802 1..1114 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:35 Download gff for FMO10139.5prime
Subject Subject Range Query Range Percent Splice Strand
Rgl-RB 679..1802 1..1114 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:35 Download gff for FMO10139.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 13910484..13910585 36..137 100 <- Minus
3L 13909832..13910215 138..521 100 <- Minus
3L 13909256..13909768 522..1030 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:10 Download gff for FMO10139.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 13903584..13903685 36..137 100 <- Minus
arm_3L 13902932..13903315 138..521 100 <- Minus
arm_3L 13902356..13902868 522..1030 98 <- Minus