Clone FMO10141 Report

Search the DGRC for FMO10141

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:41
Vector:pMK33-CFH-BD
Associated Gene/Transcriptl(2)gl-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10141.5prime Sequence

1120 bp (1037 high quality bases) assembled on 2010-11-05

> FMO10141.5prime
CAGTCGACATGTTAAAGTTTATCAGAGGAAAAGGGCAGCAGCCCAGTGCT
GACAGACAACGCTACATCACGGCACAGCATGGCTTTCCTCATAAGCCTTC
GGCTCTTGCGTATGATCCAGTTTTGAAACTTATGGCAATAGGGACGCAAA
CAGGGGCTTTAAAAGTTTTCGGTCAACCCGGAGTTGAATTGTACGGTCAG
CATACTTTGTTAAACAATTCAGCATCGGAGCTTAATGTACAATTACTTGA
ATGGGTGTATGGAACTGGTCGCATACTTTCGTTGACGGCAGCGAATCAAT
TAATTCTATGGGAGCCAGTTGGAGCAACGTTGCTGCCAATCAAAACACTA
CCGTTTGACGGCAAACTTAAAAAAGTTTCATCGCTGTGCTGTTCTCTCAG
TAAGGATCTGCTATGGATTGGAACAGAAGGTGGAAACATCTATCAACTGG
ATTTACATACATTTACCATTAAGGAGCCTGTAATTTACCATGACGTTGTG
CTAGAGCAGGTGCCACCAGCCTACAAGCTAAATCCTGGTGCAATTGAGTC
AATCCGCCAACTTCCAAACTCCCCTAGCAAACTTCTAGTTGCATACAATC
GCGGCCTTTGTGTTTTGTGGGATTTTGAAAGCGCATCTGTCCAGCGAGCA
TACATAGCCCCTGGACATGGACAGAGCGTTGGTCTTACAGTGAACTTCGA
AGGATCTGAATTTACCTGGTACCACGCTGATGGTTCATACGCCACTTGGA
GCATAGATAACCCAGAACCGCCGTCGAATGTTAATTATGTGCCTTATGGA
CCTGATCCATGCAAAAGCATAAATCGACTGTACAAAGGCAAGCGAAGATC
CAACGATGTAATTGTTTTTTCCGGCGGCATGCCACGGTCAGCATATGGTG
ATCACAATTGTGTGTCCGTTCACGCCAGCGATGGACACAAAGTGTGTCTT
GACTTTACGTCTAAAGGTGATTGACTTTTTTGTGACCTTTGAAAATAATA
GAAATGTCCGCTGAAGTCTTGTTGTACTACTTGAAGAAGGACTCTCTGCC
CCTTACGATTCTTACTGACCTAATTATTTTGGTGCTATCAAAGCGCGAAT
CTTCATCTTGTTCATGCACT

FMO10141.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:57
Subject Length Description Subject Range Query Range Score Percent Strand
l(2)gl-RB 5155 CG2671-RB 317..1421 8..1118 5160 98.3 Plus
l(2)gl-RF 5082 CG2671-RF 239..1348 8..1118 5100 97.9 Plus
l(2)gl-RE 5225 CG2671-RE 382..1491 8..1118 5100 97.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:55
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 14933..15711 847..69 3895 100 Minus
2L 23513712 2L 14678..14876 1045..846 810 97 Minus
2L 23513712 2L 19885..19945 68..8 305 100 Minus
2L 23513712 2L 17083..17136 62..9 255 98.1 Minus
Blast to na_te.dros performed on 2014-11-26 16:52:56 has no hits.

FMO10141.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:51 Download gff for FMO10141.5prime
Subject Subject Range Query Range Percent Splice Strand
l(2)gl-RB 309..1417 1..1118 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:13 Download gff for FMO10141.5prime
Subject Subject Range Query Range Percent Splice Strand
l(2)gl-RB 313..1421 1..1118 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:39 Download gff for FMO10141.5prime
Subject Subject Range Query Range Percent Splice Strand
l(2)gl-RB 313..1421 1..1118 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:39 Download gff for FMO10141.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 17075..17136 9..68 91   Minus
2L 14933..15711 69..847 100 <- Minus
2L 14610..14874 848..1118 93 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:13 Download gff for FMO10141.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 17075..17136 9..68 91   Minus
arm_2L 14933..15711 69..847 100 <- Minus
arm_2L 14610..14874 848..1118 93 <- Minus