Clone FMO10142 Report

Search the DGRC for FMO10142

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:42
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPapss-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10142.5prime Sequence

1140 bp (1010 high quality bases) assembled on 2010-11-05

> FMO10142.5prime
CAGTCGACATGTTTACCCGATGTGCCAATTCGCTTGGCCTCTACCATAAT
AATATTAACAATAACAACAGCGCTTGCTGTGCCGCTTCCCCGAAAAGAAG
CTGCCTTCCGAGTGTGGAAAAGCCTGAAGATGCGTGCCTACAGGTGGCGA
CGAATGTGACCGAGCAAAAGCACCATGTCACCAGGGAGACGCGCGGCAAG
AATTTGGGACTCTGTCGAGGATTCCGAGGATGCACGGTGTGGCTGACTGG
CCTCAGTGGAGCTGGAAAGACCTCGATTGCCTTCGAACTGGAGGCGTACC
TGGTATCCCGGGGCATTCCGGCCTACGGGTTGGACGGCGACAACATTCGC
ACCGGACTGAACAAGAACCTGGGCTTCACGCCCGCCGATCGCGAGGAAAA
CATTCGCCGCGTGGGCGAGGTGGCCAAGTTGTTTGCCGACAGCGGAGTGG
TGGCCATCTGCAGCTTCGTTTCGCCCTTCGCCGACGATCGTGAGATGGCG
CGCAAGATCCACAAGGATGCGGGTCTGAAGTTCTATGAGATATTCGTGGA
CACACCGCTGGATGTGTGCGAAACCCGGGACGTGAAGGGTCTATACAAGA
AGGCGCGCGAGGGCGTAATCAAAGGATTCACGGGCATTACGCAGGAGTAC
GAGCGACCCCAGATGCCGGAGCTGGTGGTCAACACGCACGGCTACACGGT
GCGCGAGTCCACTCAGAAGCTGGTGACGCTGCTCGAACAGGAGGGCATTA
TTCCGCGCTCGCTGCGCGACGTAGACCTGCTGCCGGAGCTTTATCCCAGC
GAATCCATTGCCACGGAGGCACTGCGTCACGAGGCCGAGTCGCTGCAAGC
CATCGAAATCAGCACCGTGGAGCTGCAGTGGGTGCAAGTACTGGCCGAGG
GATGGGCATATCCACTGCGCGGCTTCATGCGCGAGGATGAGTACCTGCAG
ACGCTGCACTTCAAACACCCTTCAGAGCGGCATGGACGTTCCTTTCGCGA
GAACCACTCGGTGCCCATTGTTTTGAACGCCACGCCAGCCGAACAGAATC
GTCTGAACGCTGCTCCTCGCTGACTCTTCAAATAACCAGCAAGGCGGTTA
GCATTCTCTGCGCCGTTCCCGGTCTAACTTTCAGCGTAGG

FMO10142.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:00
Subject Length Description Subject Range Query Range Score Percent Strand
Papss-RD 2457 CG8363-RD 170..1298 9..1138 5175 97.8 Plus
Papss-RG 2432 CG8363-RG 269..1273 133..1138 4555 97.5 Plus
Papss-RB 2394 CG8363-RB 231..1235 133..1138 4555 97.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:59
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19858814..19859643 249..1077 3855 98.4 Plus
3L 28110227 3L 19847478..19847603 9..134 630 100 Plus
3L 28110227 3L 19858377..19858493 134..250 585 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:52:59 has no hits.

FMO10142.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:52 Download gff for FMO10142.5prime
Subject Subject Range Query Range Percent Splice Strand
Papss-RD 168..1298 9..1140 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:15 Download gff for FMO10142.5prime
Subject Subject Range Query Range Percent Splice Strand
Papss-RD 170..1300 9..1140 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:40 Download gff for FMO10142.5prime
Subject Subject Range Query Range Percent Splice Strand
Papss-RD 170..1300 9..1140 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:40 Download gff for FMO10142.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19858815..19859646 250..1081 98 -> Plus
3L 19858378..19858492 135..249 100 -> Plus
3L 19847478..19847603 9..134 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:15 Download gff for FMO10142.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19851915..19852746 250..1081 98 -> Plus
arm_3L 19851478..19851592 135..249 100 -> Plus
arm_3L 19840578..19840703 9..134 100 -> Plus