Clone FMO10143 Report

Search the DGRC for FMO10143

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:43
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPapss-RE
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10143.5prime Sequence

1150 bp (1025 high quality bases) assembled on 2010-11-05

> FMO10143.5prime
CAGTCGACATGCCGAATCCGCCAATTGGATTTTATCCCCATATCAAAAGA
AGGTGCCTACAGGTGGCGACGAATGTGACCGAGCAAAAGCACCATGTCAC
CAGGGAGACGCGCGGCAAGAATTTGGGACTCTGTCGAGGATTCCGAGGAT
GCACGGTGTGGCTGACTGGCCTCAGTGGAGCTGGAAAGACCTCGATTGCC
TTCGAACTGGAGGCGTACCTGGTATCCCGGGGCATTCCGGCCTACGGGTT
GGACGGCGACAACATTCGCACCGGACTGAACAAGAACCTGGGCTTCACGC
CCGCCGATCGCGAGGAAAACATTCGCCGCGTGGGCGAGGTGGCCAAGTTG
TTTGCCGACAGCGGAGTGGTGGCCATCTGCAGCTTCGTTTCGCCCTTCGC
CGACGATCGTGAGATGGCGCGCAAGATCCACAAGGATGCGGGTCTGAAGT
TCTATGAGATATTCGTGGACACACCGCTGGATGTGTGCGAAACCCGGGAC
GTGAAGGGTCTATACAAGAAGGCGCGCGAGGGCGTAATCAAAGGATTCAC
GGGCATTACGCAGGAGTACGAGCGACCCCAGATGCCGGAGCTGGTGGTCA
ACACGCACGGCTACACGGTGCGCGAGTCCACTCAGAAGCTGGTGACGCTG
CTCGAACAGGAGGGCATTATTCCACGCTCGCTGCGCGACGTAGACCTGCT
GCCGGAGCTTTATCCCAGCGAATCCATTGCCACGGAGGCACTGCGTCACG
AGGCCGAGTCGCTGCAAGCCATCGAAATCAGCACCGTGGAGCTGCAGTGG
GTGCAAGTACTGGCCGAGGGATGGGCATATCCACTGCGCGGCTTCATGCG
CGAGGATGAGTACCTGCAGACGCTGCACTTCAACACACTTCAGAGCGGCA
TGGACGGTTCCTATCGCGAGAACCACTCGGTGCCCATTGTTTTGAGCGCC
ACGCAGCGGACAAGGATCGTCTGGACGGCTGCTCCTCGCTGACTTCTCAA
ATACCAAGGCAAGGCGGTAGCCATTCTTGCGGCGTCCCGAGTTCCTACTT
TCAGCGTAAGGAGGAAGGGCTGACCGCCAGTTCGGCACCAAGCCATTCCC
ATTCACCGTAAGTAGCAGGTCTTCACAATCGGAATATTTTGGTCGGGTGG

FMO10143.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:04
Subject Length Description Subject Range Query Range Score Percent Strand
Papss-RH 2686 CG8363-RH 480..1593 9..1122 5255 98.6 Plus
Papss-RF 2729 CG8363-RF 523..1636 9..1122 5255 98.6 Plus
Papss-RE 2396 CG8363-RE 190..1303 9..1122 5255 98.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:02
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19858814..19859735 168..1090 4315 99 Plus
3L 28110227 3L 19858377..19858493 53..169 585 100 Plus
3L 28110227 3L 19848354..19848398 9..53 225 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:53:03 has no hits.

FMO10143.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:52 Download gff for FMO10143.5prime
Subject Subject Range Query Range Percent Splice Strand
Papss-RF 519..1618 9..1110 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:16 Download gff for FMO10143.5prime
Subject Subject Range Query Range Percent Splice Strand
Papss-RE 190..1289 9..1110 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:43 Download gff for FMO10143.5prime
Subject Subject Range Query Range Percent Splice Strand
Papss-RE 190..1289 9..1110 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:43 Download gff for FMO10143.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19858815..19859754 169..1110 98   Plus
3L 19858378..19858492 54..168 100 -> Plus
3L 19848354..19848398 9..53 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:16 Download gff for FMO10143.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19851915..19852854 169..1110 98   Plus
arm_3L 19851478..19851592 54..168 100 -> Plus
arm_3L 19841454..19841498 9..53 100 -> Plus