Clone FMO10144 Report

Search the DGRC for FMO10144

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:44
Vector:pMK33-CFH-BD
Associated Gene/Transcriptsdt-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10144.5prime Sequence

1119 bp (1030 high quality bases) assembled on 2010-11-05

> FMO10144.5prime
CAGTCGACATGGTCGTGTCCACTTTGCACATAACGCTGGAGAACAACGGC
AATGTTGCTGCGGGGCAGCCTGCTGCCGTTGCTGCTGCCAGTGTCGTTGG
GGCAGCAACATCGCCGACCAAGTTTGCCGTGCTGTCGGCGCAGCAGCTGC
AACTGCAACTGCAGCAGCAGCAGCAGCAGCAGAACGAAAAGGAGAACCAT
ATGAACAATAATAACAATAACAGCGACTATTGTGATATGAATGGCAATGG
AGTTGGAATGGGAAACGGTGGTAGTGGTGGACCGGGATCTCTGACCCCCC
AATCCCCCGACCAATATGTCGGCTCACCTGTATCATCCGCTGCCACGCCC
CAGCGCACCGCCTCCGCCCTGCGTCGCGGCATTCAAATTCAACGATCCTC
GACGCGTTTGCGACAACAACAGGAGCAACTGCGCCGACGACGCGAGGAGG
AGGAGCGCATAGCGCAGCAAAATGAATTCCTGCGGAACAGTCTTCGTGGC
TCCAGGAAGCTGAAGGCGCTTCAGGATACGGCTACGCCCGGTAAAGCGGT
TGCCCAGCAGCAGCAGCAGGCAACGCTGGCCACCCAGGTGGTTGGCGTGG
AGAATGAGGCATATCTGCCCGACGAAGACCAGCCGCAGGCGGAACAGATC
GATGGCTATGGCGAACTGATAGCGGCCCTTACCCGCCTGCAAAACCAGCT
GAGCAAGAGCGGACTGAGCACGCTGGCGGGTCGCGTTTCGGCCGCCCACA
GTGTCCTGGCCAGCGCCAGTGTGGCCCATGTCCTGCCCGCTCGCACCGCA
GTACTGCAGCGACGACGTTCCCGCGTCTCTGGTCCACTGCATCACAGTTC
CCTCGGATTGCAGAACGACATTGTGGAGCTGCTAACGCAATCGAATACGG
CGGCGGCCATCGAGCTGGGCAACCTGCTGACCAGCCATGAAATGGAGGGT
CTGCTACTGGCCCACGATCGCATTGCCAATCACACGGATGGCAACGCCCT
CGCAACGCCCACGCCCACTCCGGCAATTGGAGCGGCGACGGATCGACACT
CAGCAGTCCGGTGGCCTGAACCAATAGAATCTAGTATGGTGGTTCCACGG
CCCTGGTACACCGCCCATG

FMO10144.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:09
Subject Length Description Subject Range Query Range Score Percent Strand
sdt-RK 3790 CG32717-RK 170..1281 9..1115 5270 98.7 Plus
sdt-RD 3838 CG32717-RD 218..1329 9..1115 5270 98.7 Plus
sdt-RN 5650 CG32717-RN 2441..3141 420..1115 3215 97.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:05
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 8232493..8232907 9..423 2075 100 Plus
X 23542271 X 8235881..8236307 654..1079 1900 97.9 Plus
X 23542271 X 8235585..8235821 419..655 1185 100 Plus
Blast to na_te.dros performed 2014-11-26 16:53:07
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6722..6817 167..70 116 59.2 Minus

FMO10144.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:53 Download gff for FMO10144.5prime
Subject Subject Range Query Range Percent Splice Strand
sdt-RD 208..1295 1..1084 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:18 Download gff for FMO10144.5prime
Subject Subject Range Query Range Percent Splice Strand
sdt-RD 208..1295 1..1084 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:45 Download gff for FMO10144.5prime
Subject Subject Range Query Range Percent Splice Strand
sdt-RD 208..1295 1..1084 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:45 Download gff for FMO10144.5prime
Subject Subject Range Query Range Percent Splice Strand
X 8235882..8236313 655..1084 97   Plus
X 8235592..8235820 426..654 100 -> Plus
X 8232483..8232910 1..425 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:18 Download gff for FMO10144.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 8129915..8130346 655..1084 97   Plus
arm_X 8129625..8129853 426..654 100 -> Plus
arm_X 8126516..8126943 1..425 98 -> Plus