Clone FMO10145 Report

Search the DGRC for FMO10145

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:45
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15533-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10145.5prime Sequence

1051 bp (777 high quality bases) assembled on 2010-11-05

> FMO10145.5prime
CAATCGACATGAAAGCAATCGGAATCCTGCTGGCGATCGCCTTGACCTCC
GGGTTCCTGGTGGTCTCCGCCGTAAACTTGCCGGGAGTGCCCGTGGACTT
CTACCTGGACGACCACATCCTGTCCGCCATTGCAGACGACATAGCCGAGC
GTCTGGCCAGGGAGTACATCACCTTCCTGAAGACCGGAGTGGAGACGGCG
GAGTTCTTGAAGCTCACCAATCAGCTGGCCAAGTCGCACAGTGAGAAGGA
TATATTCACCAGGAACATGCCCGATCTAGAGCCCAGGGATAGCTTCTTTG
CGTGCGTGGCCTGTCGCTCGGTGACGCGGGTTTTGATTCGCACCATTCGC
GAGGAGGACGGCGAGCTCCACGGGGAGAATAGCTCCGTTCTGATGAAGGA
ATTCGCTATGGACGTGTGCCGCCGCTTGAATCTGCAAACGGAGGAGGTCT
GCGAGGGATTGATCGATTCCAACCTGCCCTCCGTGGAGTACATCATGAGG
AACTCCGAGAGTGATTCCCAGAGCTTCTGCTCCTTGTTCATGGAGTTTAA
CTTCTGTAACACCGGTACAAATCAAGATTACAATTGGACCTTGACTATAG
ACAATACTGGAGAGGCTTCGGCTGGCCCCAAATCGGACACTCCCACCTTT
CAGGACTCGGACATCATGATCTGCCAGTTCTCCGACATTCACCATGATCC
CTACTACACCCCCGGCAGCCTGGCCACTTGTGCGGAACCCATGTGCTGTC
AGAGGAACAAGGAGACCACCGAGGGTACGTCGGATGCAGCTGGATACTGG
GGCGACTACCGGGACTGCGATCTGCCTTGGCACGCCTTCGAGTCAGCATT
GGACAACGCGGTGGCCAACTCCAAGTGCGACTTCATTTACCAGACTGGCG
ACATAGTGGACCACATGGTGTGGGCACTTCCGAGGAGAATACACCATGGT
GCTGACAAAGTCAGTGATCGGCTAACGCGCCTTCGGAGATGTACCCGTAT
ATCCCTGCATCGGAATCACGAGCTTCTTCCACTCGACCTCTTCAGTCCGA
G

FMO10145.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:12
Subject Length Description Subject Range Query Range Score Percent Strand
CG15533-RA 2203 CG15533-RA 22..1068 8..1048 4905 98.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:10
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 30428841..30429878 8..1039 4710 98.3 Plus
Blast to na_te.dros performed on 2014-11-26 16:53:11 has no hits.

FMO10145.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:54 Download gff for FMO10145.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15533-RA 11..1066 1..1051 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:20 Download gff for FMO10145.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15533-RA 17..1072 1..1051 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:48 Download gff for FMO10145.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15533-RA 17..1072 1..1051 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:48 Download gff for FMO10145.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 30428836..30429878 1..1039 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:20 Download gff for FMO10145.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 26254558..26255600 1..1039 97   Plus