Clone FMO10146 Report

Search the DGRC for FMO10146

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:46
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG13160-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10146.5prime Sequence

1141 bp (1008 high quality bases) assembled on 2010-11-05

> FMO10146.5prime
CAGTCGACATGGGAGCCACTAGGAATGGCAAGTCCCTTTCGGGGTCTGAG
AACCTAATAATCGAGGTGGATGAGGACAAGATCCGTTGCAAGCAGTATTC
CTGGTACTTTGCCCCCATCTACCTCCTGTTCTGGGTGGGTCTCTTCTTCG
CCGTCATATATCCACTTTTCCAGGCCTTGCCCACCGGAATCAAAATCTCC
GAGGAGGCGGATAAACCGGGACAATTCGTGGCCGAGAGAGCTCAGGAAAT
ACTGCTGCAAATAAGTCGATTGGGACCCCGTGTGGTGGGTGATGTTGATA
ATGAAGTCACAGTTGTGAATTTGCTGCTCGCTGAAATCGAAAAAGTGCGC
CAGGTGCTGCGAGACGATGTCTATGAAATGGAGGTGGAGGTGCAACGGGC
ATCCGGATCCTACTTGATCAAAGGCCTAACGAATCACTATCAGGGTGTGC
AGAATGTGATCGTTAGACTGAGTACGAAGAGCTCAAATAGCACCTCCTAC
CTTTTGGTCAATAGTCACTACGATACCAAGCCGGGTTCACCTGGTGCCGG
AGATGATGCTGCCATGGTTGTCGTAATGCTGGAGGTACTGCGTCTGGTCG
CCGTTTCAGGGGATCCCTTCCTGCATCCGATTATATTCCTTTTCAATGGT
GCCGAAGAGCAGCCAATGCAGGGATCACATGGTTTCATCACGCAGCACAG
ATGGGCTGCCAACTGCAAGGCTCTACTGAACTTGGATTCCGCTGGCGCTG
GTGGACGTGATTTGCTCTTCCAGGGCGGTCCCAATCATCCCTGGCTGATG
GAGCATTACAGAAACAGTGCCCCGCACCCGTTCGCCACCACAACGGCCGA
GGAGATGTTCGAGGCTGGTATCATACCATCGGATACTGATTTCCCGGATC
TTTCGGGACTTTGGAGTTGTGCCAGGCTTGGACATGGCCGGCGTGTACAT
GGATTCGTTTATCACAACGAAATTCGATCCGCTACGCGGTGATAGTCCTC
GATTCCCTGCAGAATCCGGCGACAATTAACTGGCCTTGGTATGGGAGTAT
TCGATGCCGAGAAATGTACGAAACAGAAAGGCCCACCGCCGAGGAATGCA
GATCTCTCGCACTTTATTGGAACTGTCTTGTCAATAACAGG

FMO10146.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:28
Subject Length Description Subject Range Query Range Score Percent Strand
CG13160-RA 2733 CG13160-RA 69..1138 9..1077 5070 98.8 Plus
CG13160-RB 2736 CG13160-RB 69..1141 9..1077 5030 98.5 Plus
CG33012-RC 2849 CG33012-RC 604..1114 456..966 495 74.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:26
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12371764..12372279 31..546 2580 100 Plus
2R 25286936 2R 12372332..12372508 543..719 885 100 Plus
2R 25286936 2R 12372808..12372931 802..926 575 99.2 Plus
2R 25286936 2R 12372564..12372648 719..803 425 100 Plus
2R 25286936 2R 12372993..12373114 923..1044 360 93.5 Plus
2R 25286936 2R 12368340..12368411 729..800 195 84.7 Plus
Blast to na_te.dros performed on 2014-11-26 16:52:27 has no hits.

FMO10146.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:47 Download gff for FMO10146.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13160-RA 67..1145 9..1089 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:00 Download gff for FMO10146.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13160-RA 69..1147 9..1089 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:25 Download gff for FMO10146.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13160-RA 69..1147 9..1089 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:25 Download gff for FMO10146.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12372996..12373151 926..1081 91 == Plus
2R 12372810..12372930 804..925 99 -> Plus
2R 12372564..12372648 719..803 100 -> Plus
2R 12372333..12372507 544..718 100 -> Plus
2R 12371766..12372276 33..543 100 -> Plus
2R 12371662..12371685 9..32 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:00 Download gff for FMO10146.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8260501..8260656 926..1081 91 == Plus
arm_2R 8260315..8260435 804..925 99 -> Plus
arm_2R 8260069..8260153 719..803 100 -> Plus
arm_2R 8259838..8260012 544..718 100 -> Plus
arm_2R 8259271..8259781 33..543 100 -> Plus
arm_2R 8259167..8259190 9..32 100 -> Plus