Clone FMO10147 Report

Search the DGRC for FMO10147

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:47
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG10353-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10147.5prime Sequence

1148 bp (1035 high quality bases) assembled on 2010-11-05

> FMO10147.5prime
CAGTCGACATGGACGAGCGGGAGAGTCTGTACTTCGACACCATATCGCTG
GCGGAATCGGAGGCGGCGGCTGCTGCGGCGGCGCATCGCAAGTCGATCTC
GCAGTCGCGCAACACCATCTACCACTCGGCGGTCGATCTGGCGGGCGATG
AGGGAGGCGGAGGAAGCGGTGGAGGAAGGCTGCGTCTGGGCGGCGGAGCA
GCCGCCGAGCACGCAGCGCTTGCCTGGCAGCCTGGATACCGTCAGTCCAC
AGCACTGGAGCACCTCAATGGCGGCGGTGGTGGTGGTGGTGATCACACGG
ATGCCGCTATCGCCGCCCAAATGATTGCCCTGCAAAACGGACGAAACCAC
CTGCCCACCGGGATCGGTGTGACCGGAGATGGAGGACAAGGAGGTGGTGA
CGATGAGACATACAGACGCTTCGACGATGGCAAACGGAGCGTGGACTTTG
TGCTGGCTTACAACGGAGAGACGCAGCTGGAGGAGCATCGGCGCAAATGC
GAGATCTTTGAGGCGAATCTGCAGCGAGAGGGCTTGCAGCTGGAGCACAA
CAAGGTGCAGCGCGTCCATTTCATCAAGATCCATGCGCCGGCGGAGGTGC
TGTACCGCTATGCGGAAATACTCAAGATTAAGGTGCCGCTCAAACCGATT
CCCGGCCAGGATCAAATCTTCGCCGAATCGGCGCACGAGTTCAAGACCTG
CTTCAGTCGCATGTGCAAAAGTCTCTTCAGCTCCGTCCAATTGAATACGG
CCCTGTTTCCGGAACGCGAACCGCGCATCCATCTGGAGTTCTCCCGCAAC
TACCTGGAACTGTACGATACGGAGCACCCGAACTTTCTCGACGCCAGCAC
CCGCTACTCCATCATCAATTTCATTCTCCAGCGCCAGCGTTTCGTGGAGG
GCGAGGAGACGGCCGACAATCTGGGCATCGAGAGCTCGTCCAGGATGGCG
TAATATACCTGCGCCTACACCTTGCATGATAAAGACGATCGGCGATCGGC
TGCTAAGGGTGGGGCCACATATTCCAAGTGGAAGAACCTGCAACCACTGG
ACCAAATTAAAGACTACTTTGGGAGGCAAAGTGGCACTCTACTTTGCTGG
CTGGGAATTCTACCACGCAATGCTGATACCATAGCGGTGTTCCGGCGT

FMO10147.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG10353-RK 4482 CG10353-RK 522..1642 9..1130 5270 98.6 Plus
CG10353-RI 4771 CG10353-RI 811..1931 9..1130 5270 98.6 Plus
CG10353-RC 4203 CG10353-RC 243..1363 9..1130 5270 98.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:30
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 11881330..11881904 980..406 2765 99.5 Minus
X 23542271 X 11883188..11883586 407..9 1995 100 Minus
X 23542271 X 11880867..11880926 1097..1037 210 93.4 Minus
Blast to na_te.dros performed on 2014-11-26 16:52:32 has no hits.

FMO10147.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:48 Download gff for FMO10147.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10353-RC 230..1378 1..1148 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:02 Download gff for FMO10147.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10353-RC 233..1381 1..1148 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:27 Download gff for FMO10147.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10353-RC 233..1381 1..1148 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:27 Download gff for FMO10147.5prime
Subject Subject Range Query Range Percent Splice Strand
X 11883188..11883591 1..407 99   Minus
X 11881330..11881902 408..980 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:02 Download gff for FMO10147.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 11777221..11777624 1..407 99   Minus
arm_X 11775363..11775935 408..980 99 <- Minus