Clone FMO10148 Report

Search the DGRC for FMO10148

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:48
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG9772-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10148.5prime Sequence

1137 bp (1037 high quality bases) assembled on 2010-11-05

> FMO10148.5prime
CAGTCGACATGGCGGTCTTGTTTTTATCGTCACATGGCGCCTCCAGGCAT
TGGCGGTTGCGGAGGCCGAGTCGCTGGGCGTACAACAGGATGGCGATATT
CAGCAGCACAACGACGGTGGATACCACGACCAGAAAGCGCTCGACTAATA
AGAACCACGTCTCTGTTGTGGGCGCTCTAGTTTCCACTACGAAGTCATCG
CACTACGAGCACCCTTCCTCGCCCTCGGCACTAACTTTTGAGGCCCTAGA
AGAGATGGGAATCGGAATGCTTGATTCCGAAGAAAGCAGCTCCTCAGCCC
TCTCGGCCATCGCTTTGGCGGTTAGCGCCACCAGCGACGACAACTCAAAT
GAGACGACCCCGTGCGCCAGTGTGTCGCGCATGGCGCACCAGCTACAGCA
CACGCAACGGCTAAGTCTGGGCTCTACGGGGGACATCACACTGGATAGCC
CAGCTGTGGAGGATTCACTGTCGATGTCCCGTCAATCGGCCGAGAAGCTG
CAGATTCTGGCGCAGGCTAAGCGCTCGTCGTTGGGTTCTGAAGGTAGCGG
CAATTCAAACTCGCCCAGCAAACGTTTGCGCAACCCCCTGGCTGCAGTCA
CCTGTAACAACCAGATTGATGGGACTGCTTCGCTCAATTTTCAGCCATCA
ACCAGCAGGTTGGCGCAAGTTCGCCAGGCAAAAAAGCCCTCGACAACAAA
TATTACAACCCGAATAGTGGCAGCGGACAGTTTCTTTGTGTTTCGCACCC
CGGCCATGAGTGCCCACATCAACAGCGGCATAAACTACTTTGAAAGACTT
TCAGACGAAATACTACTTGACATCTTTAAGTGGCTCCCGAAGAAGACGCT
GCTGCGCATGGCTACCGTTTGTCGACGCTTTAACCGCTGCTCTCGCGATG
AGACTTTGTGGACAAGGCTAGATTTGGGTTTGCGGACATTAGACCAGTGC
CCTCGAGCAAATTGTACGGCGGGGAGTCCTTGTATACGTCTGGCCCAGAA
CTAGTATCCAGGAGCCGCATTTGCACCATAAAACAGAATGTTTAGGACCC
GATACAATTTTCTTGACTGATATGGCTCCATCACCGGAGCTCCCTGGCTG
AACCTATTGTCCCAATTGCGCCAGCTTAGGAATAGCT

FMO10148.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:52:37
Subject Length Description Subject Range Query Range Score Percent Strand
Skp2-RE 1853 CG9772-RE 122..1126 128..1126 4560 97.7 Plus
Skp2-RA 2412 CG9772-RA 122..1126 128..1126 4560 97.7 Plus
CG1103-RB 1223 CG1103-RB 676..800 133..9 625 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:52:35
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 4336474..4337345 999..131 4210 99.7 Minus
3R 32079331 3R 4339367..4339491 133..9 625 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:52:36 has no hits.

FMO10148.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:49 Download gff for FMO10148.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9772-RB 68..1148 1..1077 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:04 Download gff for FMO10148.5prime
Subject Subject Range Query Range Percent Splice Strand
Skp2-RB 68..1148 1..1077 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:29 Download gff for FMO10148.5prime
Subject Subject Range Query Range Percent Splice Strand
Skp2-RA 122..1093 128..1092 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:29 Download gff for FMO10148.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 4339367..4339498 1..133 97   Minus
3R 4336469..4337342 134..1005 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:04 Download gff for FMO10148.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 165089..165220 1..133 97   Minus
arm_3R 162191..163064 134..1005 99 <- Minus