Clone FMO10149 Report

Search the DGRC for FMO10149

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:49
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG31531-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10149.5prime Sequence

1104 bp (1012 high quality bases) assembled on 2010-11-05

> FMO10149.5prime
CAGTCGACATGGAGGCCACTGATCAGGAGGTCATGCTGGAGGGCAGGGAA
GACCTCATGTCCACATCGGCGACATCGTCCACAAATGGCGGGGACACTAA
TGGTTGCGGCAAAAAATTGTCCGTAACCTCTCCGGATCCCACACCGTACG
TGACCAAGCAGCGAGTGACGCGTCCAACGCCTCCCGCTCCTTCAAAGAAT
CCGATGCAATTCGTCCAGATCAAGCCCTGCAACCTCTACCAGACCGCGCA
GGAGCAGCTGAAGAAGGCCGAGGAGGTCAAGAAGCTGAAGGAGGTGAAGA
AGGAGGAGCCAGAGGAGTGGCAGAACAACCTTGACAATTGGAAATCATCG
AGACGAAAACGTGTCGAACACATCATCGATCGAGCGGTGGAGACCAAGAA
ACTCGAGCTGGAGGAGCATGATCGGTTGCGCCGAAAGTCGAAAACATTCA
CCGAAATGATGGAGGAGAGGGCTGAAAGGGGCGGACCTCGGGGGCGTGCC
AAGCTGGCTTCCCTGGCCGTATACAACGAGGATGAGACGAACGACCTGAG
TGATTTGGGGATCGGAACCAGCAGTGCCAGCGGAAAGAGCAGCCTGTCCG
GGGACTATGACAATAACAGTGTTATGAGCGACCATGCGGCGGAGCTGGAT
AAGGCGATTGGAGCAGCTAGCTCTGTAGCTGCTGGAGTAACCGCCCAAAA
CGTGGATGAGCAGCTGAATCACATAAACCGCAACGGTAGTAATGGGAACC
ACGGGAACGGAGCGGCTGTTGGCCAGACAGGACCATCAAATTCCTCCAAG
TCAGCACGGCGGCAATACATCTCCTCGCCAGGATACGATACGTCCTCCAG
TAACGCGCAAGCCAGTTCTCCGGATCTCTGTGAATACACCTACGAAGGAG
CCATCCAGGACTACAAGCAAAGAGTTCAACGGGCCAGCAGCAATGGCAAT
GGAAATGCCAACGGCAAGTTGATTGAGAACATATTGCTTATCCCACGAGG
CGAGGCTCTTAAATGAGAATCGATTGATTGCTTGAGGTAACATCGCCAGC
GACACGCCAGGAGGGTGTAAGGAGCCAAAGGTGACTGCCCAAGTGACTAT
CCCA

FMO10149.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:26
Subject Length Description Subject Range Query Range Score Percent Strand
CG43427-RH 6180 CG43427-RH 614..1705 9..1093 5130 98.4 Plus
CG43427-RG 5552 CG43427-RG 831..1922 9..1093 5130 98.4 Plus
CG43427-RF 5897 CG43427-RF 1176..2267 9..1093 5130 98.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:24
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 4701157..4701604 626..1069 1890 97.3 Plus
3R 32079331 3R 4698048..4698255 119..326 1040 100 Plus
3R 32079331 3R 4700169..4700327 468..626 795 100 Plus
3R 32079331 3R 4699717..4699860 327..470 720 100 Plus
3R 32079331 3R 4697432..4697542 9..119 555 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:53:25 has no hits.

FMO10149.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:56 Download gff for FMO10149.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31531-RC 818..1918 1..1093 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:27 Download gff for FMO10149.5prime
Subject Subject Range Query Range Percent Splice Strand
CG43427-RF 1167..2267 1..1093 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:55 Download gff for FMO10149.5prime
Subject Subject Range Query Range Percent Splice Strand
CG43427-RF 1167..2267 1..1093 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:55 Download gff for FMO10149.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 4701158..4701601 627..1065 97 -> Plus
3R 4700171..4700327 470..626 100 -> Plus
3R 4699717..4699859 327..469 100 -> Plus
3R 4698049..4698255 120..326 100 -> Plus
3R 4697423..4697542 1..119 96 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:27 Download gff for FMO10149.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 526880..527323 627..1065 97 -> Plus
arm_3R 525893..526049 470..626 100 -> Plus
arm_3R 525439..525581 327..469 100 -> Plus
arm_3R 523771..523977 120..326 100 -> Plus
arm_3R 523145..523264 1..119 96 -> Plus