Clone FMO10151 Report

Search the DGRC for FMO10151

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:51
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8232-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10151.5prime Sequence

1127 bp (1042 high quality bases) assembled on 2010-11-05

> FMO10151.5prime
CAGTCGACATGGATTACGTGTATTGCGGCACCGACCCCATCGGGGCCTCC
GAAGACATACTAAGTGTTTATGACGCGGGATCTGCGCCGGGAAACGGGCA
CTTTTCGCCCAGCTTCAATGGATTCAACATCGGCACCACCGATCCGGAAT
ATGTGGAGCTTGTGCCCGTGCTTGCCGACGGCGGGGAGCACTTCGGCGTT
TCCAGCGTGGCGTTCGACGACTACGAAGAGCTGCTGTGGATGGGCAACCA
GGGCGGCCACGTCACATCGTACTACACAAACTCCATGCAGAAGTACACAT
CCTTTCAGGTCCACGCCACCGACATTGTGCGCGACATCTCCACCCTGGAC
TCCGGAGTGCTGGCGCTCACGCAGACCTCGCTGCGTCATCAGATCCGCAG
GGGTCTGCCCAAGTTTACCTTCAAATCGAACAACATGAAGGAGATGGTGA
GCATGCTGCAGCTATCACCGCATCGTCTGGTCATGGCCGGACTGCAGGAC
GAGCTTATCGACTTCGACCTGCGCACGCTCAAGGAAACCCGCATAGAGCA
TGTGGGTGCCGGCGGATGCACGGTGCTACGCAAGAATTCACGTTATCTGT
TTGCCGGCGACCAGCTGGGAACGGTAACGTTGCGCGACCTGAACAGCCTG
AGTGTTCAGCACACAATCAAGACGCACACCAACATCCTTTCGGACTTCAG
TGTCCAGGGAAATCTGCTAATCTCTTGCGGCTACAGCGGAAGGCAAAATA
ACCTGGCCATCGACCGCTTCCTAATGGTCTACGATCTGCGCATGCTGCGC
CTGATCGCGCCCATTCAAGTGATGATTGATCCGCAGATGTTGAAGTTCCT
GCCATCGCTGACATCCCAACTGGCCGTCGTGTCCAGCTACGGCCAGGTTC
AGCTGGTGGACACTGTGGAGCTCAGCGAGCCGCGAGTATCCATGTACCAG
ATCAACACCAACGGCAGCAGTGCCTCAGCTTCGACATTAGCCTCCCTCTT
CACAAGCCATGGCATTTGGGGAACAGTCGGGCCCATCAACATGATGCGCT
GTTACAACGCCCTCAGCCGCAGGTCCATTTCTACTCCCGGAAGCCAAGGT
TGCGAGACGTGGTGCCAAGCTGCGAAT

FMO10151.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:30
Subject Length Description Subject Range Query Range Score Percent Strand
PAN2-RB 4048 CG8232-RB 132..1248 9..1123 5160 98.1 Plus
PAN2-RA 4051 CG8232-RA 132..1248 9..1123 5160 98.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:28
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 8928936..8929556 425..1045 2905 98.9 Plus
2R 25286936 2R 8928458..8928649 64..255 960 100 Plus
2R 25286936 2R 8928709..8928878 255..424 850 100 Plus
2R 25286936 2R 8928300..8928357 9..66 290 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:53:29 has no hits.

FMO10151.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:57 Download gff for FMO10151.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8232-RA 121..1247 1..1127 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:31 Download gff for FMO10151.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8232-RA 126..1252 1..1127 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:57 Download gff for FMO10151.5prime
Subject Subject Range Query Range Percent Splice Strand
PAN2-RA 126..1252 1..1127 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:57 Download gff for FMO10151.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 8928936..8929640 425..1127 96   Plus
2R 8928709..8928878 255..424 100 -> Plus
2R 8928458..8928648 64..254 100 -> Plus
2R 8928294..8928354 1..63 93 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:31 Download gff for FMO10151.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 4816441..4817145 425..1127 96   Plus
arm_2R 4816214..4816383 255..424 100 -> Plus
arm_2R 4815963..4816153 64..254 100 -> Plus
arm_2R 4815799..4815859 1..63 93 -> Plus