Clone FMO10152 Report

Search the DGRC for FMO10152

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:52
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG13643-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10152.5prime Sequence

1112 bp (1029 high quality bases) assembled on 2010-11-05

> FMO10152.5prime
CAGTCGACATGCTGAGCATTATAAATGCAATGATTGCCTTCCTCCTGGCA
ACGACACTTTGCAGTGGATACGGATACGCGCAGGCCCAGTTGCTCGACGA
GGACGACGACCTGGCCTTCGGAAGGCCCTGGCCCACCTACAGCCTACAGA
ACATGCCCAAGACGCAGTTCACCTGCCACGACAAGATCCTGGGTGGCTAC
TATGCCGATCCGGAGACCCAGTGCCAGATGTTCCACGTCTGCGTCAAGCT
GCCCGGAGTGGGGGTGCAGGACTATCGATTCCTCTGTCCCAACACAACGG
CCTTCGACCAGGAGCTGCAAATCTGCGCCAATTGGTTGGATGTGGACTGC
GACAAGGCAACCTCCTTCTACGACAATGGCCACCTCAACGATCTATATCG
CAACGGAGACGAGAGCAAATCTGCCAACGAAGAGGAGGCAACCTTCCACC
TTCAACGCGCCGAAACGGGCGATATACGTCGCTCTAAGGAGAACCACAAT
AATAACAATATTAACAACAATCGTGGAGCGGACCAAAAACCACGCCATCG
CCACAATTATGCCCAGACAGGTGGCAGCTCTAGTTCCAGCTCCAGTCCCA
AATTGGAGATCACGCAATCCACCAAGCGACCCATTTCCACCTATTACACG
CCGACCACTTTGGGCAGCACCACCACATCCACTACATCGACCACAACCAC
GACGGAACGCAGCTATTACAACAATAATTACAACAACAATTACAGCAACA
ATGACGACTCGAAGCAAGATTTAGACGATATCTTCAAGGGTTCACACAGC
TCGCACTTCTTCTCCAACCGCCACGGGGGTCGGGAATACGACGAGGAACC
CAGCCGGCCCAAGCCCAACGACTTTTCGGATTACCAGCGCAAGACGACCC
GGGTCACGCCCACGCGCGGTGTTCAACGTCCAACTTCCGGTCGAGTAGTC
CGATTCCATCCAGCAACGCTGCTCCAGCACGACCAAGTCCCTGAAGAAGA
TCACCTGCATGCCACTTTCAACACGGGACTTCTGGATAAGCTCTCGCAAT
ACAAGAGAGTCCATCTTACAGGGCGGTTCACACTCCGCGGTCCAGGCAGC
AGCATTACACAG

FMO10152.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:35
Subject Length Description Subject Range Query Range Score Percent Strand
CG13643-RC 3068 CG13643-RC 195..1293 7..1105 5150 98.5 Plus
CG13643-RB 3248 CG13643-RB 375..1473 7..1105 5150 98.5 Plus
CG13643-RE 3065 CG13643-RE 195..1290 7..1105 5095 98.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:31
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 24899861..24900158 765..468 1490 100 Minus
3R 32079331 3R 24899469..24899799 1095..766 1175 93.7 Minus
3R 32079331 3R 24903207..24903425 266..48 1095 100 Minus
3R 32079331 3R 24900281..24900487 469..263 1035 100 Minus
3R 32079331 3R 24905339..24905380 48..7 210 100 Minus
Blast to na_te.dros performed 2014-11-26 16:53:33
Subject Length Description Subject Range Query Range Score Percent Strand
ZAM 8435 ZAM DMZAM 8435bp Derived from AJ000387 (e1237231) ((Rel. 54, Last updated, Version 1). 2583..2684 665..767 133 67.6 Plus
Stalker4 7359 Stalker4 STALKER4 7359bp 2849..2908 685..745 131 70.5 Plus
Stalker 7256 Stalker STALKER 7256bp 2743..2802 685..745 122 68.9 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3588..3628 722..762 115 75.6 Plus
rover 7318 rover ROVER 7318bp 1258..1290 718..750 111 81.8 Plus

FMO10152.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:57 Download gff for FMO10152.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13643-RA 184..1296 1..1112 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:33 Download gff for FMO10152.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13643-RB 367..1479 1..1112 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:59 Download gff for FMO10152.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13643-RB 367..1479 1..1112 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:59 Download gff for FMO10152.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 24905339..24905382 1..48 91   Minus
3R 24903210..24903424 49..263 100 <- Minus
3R 24900282..24900486 264..468 100 <- Minus
3R 24899861..24900157 469..765 100 <- Minus
3R 24899454..24899799 766..1112 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:33 Download gff for FMO10152.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 20731061..20731104 1..48 91   Minus
arm_3R 20728932..20729146 49..263 100 <- Minus
arm_3R 20726004..20726208 264..468 100 <- Minus
arm_3R 20725583..20725879 469..765 100 <- Minus
arm_3R 20725176..20725521 766..1112 94 <- Minus