Clone FMO10154 Report

Search the DGRC for FMO10154

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:54
Vector:pMK33-CFH-BD
Associated Gene/TranscriptACXD-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10154.5prime Sequence

1139 bp (1031 high quality bases) assembled on 2010-11-05

> FMO10154.5prime
CAGTCGACATGGACTCCTACTTCGACTCGGCCATCGAGTACAATCGATCC
AACCCCATCAGCCTGGCCAGGACCAGCAGCCAGGCCCAAACCGTGCAGAA
CGAGAAGAACTGGGAGTGGTCGTACCTTGTGAGAAAATGTCGCAACCTGG
AGCTGGAGGACTCGTACGACCTATACATGCGTCGCCTGCGCGTCGGCTAC
CTGTCGCTGTTCATCTTCATCCACGTGGCGGTGACGGTGATCCACACGCT
GCTGCTGCTGACCACGCCGGAGATCAAGTACGTGTACGTGGACATGGTGG
CCTACATGTGCTCCGGCCTGGTCATCTGGGTGGTGCTGGGCGTGAACTTT
CGCAGCGAGCTGGTGAGCAAGCACGGCTGGGTGGTCTACGCCACCTCCTG
GCTGGCGGTGTGTGTAATGGTCCTGATGGACATCGGACTGAATGTTTACC
ACGCCACCAGCCACAACGACATCCTGAATCCGATCTACGATGCGTATACG
CTGTACGCCATATACATGTTCATGCCGGTGCCGTACCTGCTGCAGCCGTT
TGTCCTTGGATCGGCAGTCACCTTTTGCTACATAATAAACTACAGCTTCG
TGATCACCGCCAAGGATGACAACCAAATGCACAGCATCCTGAACGAGGCC
ATATACCTGAGCTGTGTCAACCTACTGGGCATTTTCTTTCGCCTGATGAG
GGATATAGCGCTACGCACCACCTTCCTCGATCGCCGGCAGTATGTGGAGG
AGAATCTCCTGTTGCGCTATGCCAGGGATCAGGAGCGGAGTCTCTTGCTT
AGCATCCTGCCTGCCCAGATCGCCGATCGGCTGCAGGAGGATGTGAAGAA
CCGCATCGAGCGATCCAAGCAGCAGCACCAGCAGCAGTCGCAGTGGATCT
GCGCAGGGTGCGGATAGCCAGACCCTTAAAGTGGCGACAACCGGACCATG
GCACCCTTTTCATTGAGCCCCACGAGATGTCACCGTCCTCTACGCGGATG
GTGGTCACTAACACCCCACTTGACCACCACCCTGGATGTGTGAAGAAGCT
AGTGGAGGCTCTGCACGATCTCCTTCTGGCGTTCCGACATTGCAGCGAGG
GATTACAACTTGCCTGGAGGAATCAGTTCTTGGGCGATT

FMO10154.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:39
Subject Length Description Subject Range Query Range Score Percent Strand
ACXD-RB 4118 CG5712-RB 526..1655 8..1139 5165 97.8 Plus
ACXD-RA 4112 CG5712-RA 526..1655 8..1139 5165 97.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:36
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 2239092..2239916 131..951 3960 99.5 Plus
3L 28110227 3L 2238427..2238550 8..131 620 100 Plus
3L 28110227 3L 2239978..2240116 951..1093 350 91 Plus
Blast to na_te.dros performed on 2014-11-26 16:53:38 has no hits.

FMO10154.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:58 Download gff for FMO10154.5prime
Subject Subject Range Query Range Percent Splice Strand
ACXD-RA 518..1625 1..1109 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:35 Download gff for FMO10154.5prime
Subject Subject Range Query Range Percent Splice Strand
ACXD-RA 520..1627 1..1109 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:00 Download gff for FMO10154.5prime
Subject Subject Range Query Range Percent Splice Strand
ACXD-RA 520..1627 1..1109 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:00 Download gff for FMO10154.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 2239093..2239916 132..951 99 -> Plus
3L 2238421..2238550 1..131 96 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:35 Download gff for FMO10154.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 2239093..2239916 132..951 99 -> Plus
arm_3L 2238421..2238550 1..131 96 -> Plus