Clone FMO10155 Report

Search the DGRC for FMO10155

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:55
Vector:pMK33-CFH-BD
Associated Gene/Transcriptcrp-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10155.5prime Sequence

1128 bp (983 high quality bases) assembled on 2010-11-05

> FMO10155.5prime
CAGTCGACATGTCCGCCGTACCGGTTGCCATCAAAACGGAGGAAGTTATT
CTAGAGCACGCCGAATACAACAGCGCCGAGGAATTGGATGAGGAATTGCA
ATTGCAACTAGAGGATTCAGGGGGTGAGAACTATCACATCGAGTTCGCCA
GCGAGTCAGCTCATCAGGGTTCTCAGCGTCGACAGTCGAGCATGAGCGGT
ACGAATACCTCCAAGGGTGGAGGAGGAGGGGGCAGCGGGGCCTTGAGCGA
TGGAGACGGTTCGGGAAAGCCCCTTGTGGACAGCGAGAAGCGAATGCGTC
GGGAAATCGCCAACAGCAACGAGCGCAGACGCATGCAGAGCATCAATGCC
GGATTCCAGAGTCTGCGATCCCTGCTCCCGATACACGAAGGCGAGAAGTT
GAGCAAGGCGGCCATCCTACAACAGACCTTCCAATACATTGTGGAACTGG
AGAACCAGAAGACGCAGCTGCTGACGCAGAACAGTGAACTGAAGCGACAG
GTGGGCGAGCACGAGGCCGGCGGTTCTGGCGATGGTGGTGGTACCAACTC
CGGCGGAAACTACAATGATTCCAATGCCAGCGGGGGCAATTCCACGGCGG
TGGCCATCAAGAAACGGAAGCTGACTGATAACGTGATTAACATCCAGGCG
ATTAGTGACAGTTCCGACGAAGGTCTGGGATCGATGTCTCCAGAGCCGAT
GACTCTGCTGACAGCCGGCGGAGCGGCGGCCACCAAACTGAGCAATGCTG
CTACTCTTCTGGCGGCCAAGGAGCTGCATGAGTCGAAGAAGCAGTTGGAG
AAGGAGCGCAGTCTGCGGCGACTCCTCGAGGATGAGCTCCAGATGATCAA
GCGGCAGCTGTACAGCGTGGCAACCGCACCGCCCGGAACAGCTGTGGCCG
CCGCATCCGGCGCAGTAGTGCGCCTACATTCCACGTGAGGTTCATCGAGC
ACCCCGATAACTTTGTGCGCAGCGAGGATTTGGAGGAACTTGGCCGGCCC
TGTCCTCGTATGTCGAAATCGATGAATGACTGGCCAGCACCAGGTGGTCG
TTGCTCCACATCGAGGAACTGGAGGACGATGCCGTGCGAAATATAGCCGA
GATCAGTGCACGAGAGGTCATCTGTCTC

FMO10155.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:42
Subject Length Description Subject Range Query Range Score Percent Strand
crp-RB 4402 CG7664-RB 540..1663 7..1122 5150 98 Plus
crp-RA 3537 CG7664-RA 540..1663 7..1122 5150 98 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:40
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 16266339..16267019 1084..406 2930 98 Minus
2L 23513712 2L 16278862..16279169 408..101 1525 99.7 Minus
2L 23513712 2L 16287098..16287191 100..7 470 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:53:41 has no hits.

FMO10155.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:58 Download gff for FMO10155.5prime
Subject Subject Range Query Range Percent Splice Strand
crp-RA 531..1637 1..1101 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:38 Download gff for FMO10155.5prime
Subject Subject Range Query Range Percent Splice Strand
crp-RA 533..1639 1..1101 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:02 Download gff for FMO10155.5prime
Subject Subject Range Query Range Percent Splice Strand
crp-RA 533..1639 1..1101 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:02 Download gff for FMO10155.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 16287098..16287196 1..100 96   Minus
2L 16278863..16279169 101..407 99 <- Minus
2L 16266319..16267017 408..1101 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:38 Download gff for FMO10155.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 16287098..16287196 1..100 96   Minus
arm_2L 16278863..16279169 101..407 99 <- Minus
arm_2L 16266319..16267017 408..1101 97 <- Minus