Clone FMO10158 Report

Search the DGRC for FMO10158

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:58
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG11670-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10158.5prime Sequence

1149 bp (1067 high quality bases) assembled on 2010-11-05

> FMO10158.5prime
CAGTCGACATGGCGGATTGGAAGAGACCTTTGGAGACCTGCATCGCACTC
TGTGTGCTCCTGTGCGTATTTCACGTGAACGGACAGTGGGAGTTTCCCGC
CCAGTATCCGGAACCGTATCGAAATCCGAATCCGAATCCAGTGCCGGATC
CAACCAGACCGCCGCCGCCACCACCTTCTCCGCCATGTGGAAGACCACCG
CCTGGATCTCCGCCACCGGGCCCGCCTCCACCTGGTCCTCCACCTGGTTG
CCCCGGAGGTCCAGGAGGTCCGCTGCAGCATCGGCAATGGGACAATGGCC
CCAGGCAGTGGCAACCACGTCGTCCGCCACCAAATCACCATCGCAACTTC
CACAACATCTTCCTGAACACCGAAAGCAAAGTGGACGGGGAGAACTACAA
CAAGACCGCGGAGACGGAGGACTTGCACGACGACTTCAATGGCCGATCCA
TTGTGGCACCTGGACAGTACCCGCACATGGCCGCTCTGGGATTCCGGAAC
GAGAACCACGAGATCGACTACAAATGTGGTGGAAGCCTCATCAGCGAAGA
GTTCGTGCTCACAGCTGCTCATTGCCTGACTACTCATGGCACCTCGCCCG
ACATCGTAAAAATCGGAGACATTAAGCTCAAGGAATGGGAGCTCAACGTG
GCGCCCCAAAGACGACGTGTTGCCCAGATCTATCTGCATCCACTGTACAA
TGCGAGTCTTAACTACCATGACATCGGGCTCATCCAGCTGAATCGACCGG
TGGAATACACCTGGTTCGTGAGGCCAGTTTCGCCTGTGGCCCATGAACGA
CATACCATACGGCAAGCTGCACACCATGGGCTATGGCTCGACGGGATTCG
CCCAGCCGCAGACGAACATACTCACGGAACTGGATCTCTCGGTGGTGCCC
ATTGAGCAGTGTAACTCCAGTCTGCCAGCCGACGAAGTTCTCCCCCACGG
ATTACTCACAAGTCAGATATGCGCCCATGACTATGAGAAAATCGCGATAC
TTGCAAGGCGATTCTGGAGACCGCTTCAACTGAACTTGGAACGTCGGCGT
CGAAGCACACAGTCGTAAACTATCGCTACTACCTGTGGCAATCACATCGT
ATGGAACAAATTGGTCCCAAGGACTCAAGGGTTTAATACCGCGGTTTCA

FMO10158.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:16
Subject Length Description Subject Range Query Range Score Percent Strand
CG11670-RD 1337 CG11670-RD 43..1154 9..1113 5230 98.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:14
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 13043250..13043669 589..1008 1930 98.3 Plus
3R 32079331 3R 13042320..13042644 156..480 1625 100 Plus
3R 32079331 3R 13042092..13042240 9..157 745 100 Plus
3R 32079331 3R 13042884..13042994 479..589 555 100 Plus
3R 32079331 3R 13043722..13043834 1007..1113 240 91.2 Plus
Blast to na_te.dros performed on 2014-11-26 16:53:15 has no hits.

FMO10158.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:54 Download gff for FMO10158.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11670-RD 25..1141 9..1119 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:22 Download gff for FMO10158.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11670-RD 43..1159 9..1119 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:50 Download gff for FMO10158.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11670-RD 43..1159 9..1119 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:50 Download gff for FMO10158.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 13043251..13043668 590..1006 98 -> Plus
3R 13042885..13042994 480..589 100 -> Plus
3R 13042322..13042643 158..479 100 -> Plus
3R 13042092..13042240 9..157 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:22 Download gff for FMO10158.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 8868973..8869390 590..1006 98 -> Plus
arm_3R 8868607..8868716 480..589 100 -> Plus
arm_3R 8868044..8868365 158..479 100 -> Plus
arm_3R 8867814..8867962 9..157 100 -> Plus