Clone FMO10159 Report

Search the DGRC for FMO10159

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:59
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG18858-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10159.5prime Sequence

1128 bp (1033 high quality bases) assembled on 2010-11-05

> FMO10159.5prime
CAGTCGACATGAGGCTCAAATCGGGAGTGCTTTCGCTGCTCCTGCTGACC
ACCTTCTTGGCCCTGGGCGAGTGCTTTTGGCCATTTAGCAAATGGCATGG
AAGAAATGATAATCCTTCTGCCCCCCCTGAACCCAAGCTGTCGCCAGTGA
TATTCGTACCCGGTGACGGAGGCTCCCAAATGGATGCTCGGCTAAATAAG
CCCAACTCTCCCTATTTAATTTGCCAAAAGACCCACGATTGGTACAACCT
GTGGCTGGATCTGGAGCAGTTGGTCATCCCCATGGTCTACTGTTGGATAG
ACAATGTCAAGCTGTACTACGACAAGGTCACGAGGACCACCCACAACACT
CCTGGTGTGGAGACGAGGATACCCGGCTGGGGCAATCCCGAGGTGGTCGA
GTGGATCGATCCCACCAAGAACAGCGCCGGAGCCTACTTCAAGGATATAG
CCAATGAGCTGGTGAAACTTGGATATATTCGCAAACAAAATATTCATGGA
GCACCCTATGACTTCCGCAAAGCGCCAAATGAGAACCAACAGTTCTTCAT
CGATCTCAAGCAGCTGGTGGAGGACTCCTATGAGGCCAACAATCAGTCGG
CTGTGACCTTCATCTCGCACAGCATGGGCAGTCTCATGACCCTGGTTTTC
TTGCAGGAGCAAACCCTCCAATGGAAGGCGAAATACGTGAAGCGCATGAT
CAGCCTGGCGGGAGTTTGGGCGGGAAGTTTTAAGGCTGTGAAAGTGTTTG
CCATGGGCGATGATCTCGACTCGTTCGCCCTGAGTGCCAAGATCCTCAAG
GCGGAACAGATAACACACCCATCCACGGCCTGTTTGCTGCCCTCGCCACT
GTTTTGGAAGCCATCCGAGGTGCTCGCCATGACTCCAAGCAGAAACTATA
CGATGGCACAGCTGGAAGAGTTCTTCAAAACCTCGACTACATGACGGCTG
GGAAATGCGCAAGGACACGATTCGTACAACCGAAACTTCGATCCACGAAT
GGTGGAACTGCACTGTCTTCTATGGCGAAGCATCGACCCGTCGAAAGACT
GCAGTACAAGAAATCGACTAATGGGAACGCCCAGTGATATGATCTCGCAC
GACCGTTACACGTCCTGCGACTGCAAAT

FMO10159.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:19
Subject Length Description Subject Range Query Range Score Percent Strand
CG18858-RB 2029 CG18858-RB 431..1492 9..1066 5075 99 Plus
CG18858-RA 1817 CG18858-RA 431..1492 9..1066 5075 99 Plus
CG31683-RB 1823 CG31683-RB 437..1498 9..1066 5045 98.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:17
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 20457487..20457994 1030..525 2255 98 Minus
2L 23513712 2L 20448370..20448873 1030..529 2235 98 Minus
2L 23513712 2L 20458054..20458431 533..156 1875 99.7 Minus
2L 23513712 2L 20448937..20449314 533..156 1860 99.5 Minus
2L 23513712 2L 20449381..20449528 156..9 740 100 Minus
2L 23513712 2L 20458498..20458645 156..9 740 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:53:18 has no hits.

FMO10159.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:55 Download gff for FMO10159.5prime
Subject Subject Range Query Range Percent Splice Strand
CG18858-RA 429..1511 1..1075 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:23 Download gff for FMO10159.5prime
Subject Subject Range Query Range Percent Splice Strand
CG18858-RA 422..1504 1..1075 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:51 Download gff for FMO10159.5prime
Subject Subject Range Query Range Percent Splice Strand
CG18858-RA 422..1504 1..1075 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:51 Download gff for FMO10159.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 20458498..20458649 1..156 97   Minus
2L 20458059..20458430 157..528 100 <- Minus
2L 20457468..20457990 529..1047 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:23 Download gff for FMO10159.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 20458498..20458649 1..156 97   Minus
arm_2L 20458059..20458430 157..528 100 <- Minus
arm_2L 20457468..20457990 529..1047 97 <- Minus