Clone FMO10160 Report

Search the DGRC for FMO10160

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:60
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAxs-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10160.5prime Sequence

791 bp (791 high quality bases) assembled on 2010-11-05

> FMO10160.5prime
CAGTCGACATGTCCGAAGATGCCAAGAGTCCAGGACCACGCACACGGAAC
ATCATCGAGAATCAGCTGTTCCGCCGGCAGCGTAGCCTAAAATTGGAGGC
ACTGCAGCGCCAGCGGACCTTGGATTCCAACGATGGGGTGGAGGGATTGG
GCGCAGATACGGAACCCTTCGACAAGACGCACATCGTCATCATCTTTACG
GAGAAGGCCAAGCTAAGACACTGTCAGGATGTGGAGAAGATCATTCAGGA
GTTTGGCATCCAGACCACGCTGGAGATCGTAGGGAAAACCGAAAAGTATC
TCTACCTATCGGCCAGCGTGGATACTCTGCTCCGTTTGGCCGATGCCGCC
GAGCTGGAGAAGATGACCACCACGCACAGCATGCAAAAGTTCAATCACGG
CTGCATCTCGGACTTTCTACTGCCCGGGATGGGCAAAGAGCAGATCCTGC
GCTACTGCGAGATACCTGTTCTCATCAAGGACGTAATCCAGGACGGCATT
AAGTCCTACGTGCAAAAGGGCTACATAGAGGATATGTTTCCCCTCCACGA
TATCCTGTATCTCGAACGCTTCAACTGGAACCTGAAACGCACCAAGCTGC
CCATCGAGGACATCCGGAACTACTTTGGTTCCAGTATAGGTCTTTATTTC
GGCTTCATCGAGTTCTACACGAAGGCACTGATCTTTCCCTCCCTTTTTGG
TATACTCCAATATGTATTCGATCTGAACATCTCGCTGGTCTGCAGTTTCT
ACGTTGTTTGGACCACGGTGAGTGCAAGCTTTCTAGACCAT

FMO10160.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:23
Subject Length Description Subject Range Query Range Score Percent Strand
Axs-RA 2575 CG9703-RA 456..1214 9..767 3795 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:21
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 16682201..16682472 554..283 1360 100 Minus
X 23542271 X 16681904..16682122 773..555 1095 100 Minus
X 23542271 X 16683209..16683357 176..28 745 100 Minus
X 23542271 X 16683026..16683135 284..175 550 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:53:22 has no hits.

FMO10160.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:55 Download gff for FMO10160.5prime
Subject Subject Range Query Range Percent Splice Strand
Axs-RB 447..1226 1..781 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:26 Download gff for FMO10160.5prime
Subject Subject Range Query Range Percent Splice Strand
Axs-RA 447..1214 1..767 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:39:53 Download gff for FMO10160.5prime
Subject Subject Range Query Range Percent Splice Strand
Axs-RA 447..1214 1..767 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:39:53 Download gff for FMO10160.5prime
Subject Subject Range Query Range Percent Splice Strand
X 16683209..16683357 28..176 100 <- Minus
X 16683027..16683133 177..283 100 <- Minus
X 16682201..16682471 284..554 100 <- Minus
X 16681898..16682122 555..781 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:26 Download gff for FMO10160.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 16577242..16577390 28..176 100 <- Minus
arm_X 16577060..16577166 177..283 100 <- Minus
arm_X 16576234..16576504 284..554 100 <- Minus
arm_X 16575931..16576155 555..781 98 <- Minus