Clone FMO10161 Report

Search the DGRC for FMO10161

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:61
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG9993-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10161.5prime Sequence

1108 bp (1012 high quality bases) assembled on 2010-11-05

> FMO10161.5prime
CAGTCGACATGGCGTCCACCAAGTACGACAGCTTTGAGAAGATATGGTCT
GGGCCAAAGGACAAGGAGTACTACGGTCCGGATATGACGCTGGGCGAGGT
GGCACTGATCATCCTGCGTCTGTACTCGGACAAGGTGATGCAGGTGTATG
ATCCCACGGGCGAGGAGCTCACCGGTAGTCAGTTGCTGGAGCAAAGTCGT
CGATTGGCCCACGCCTTTCAACGATTGAAGCTGCAACGCGGCGATGTGGT
TGGCATTTCGGCCAAGAACACCACCTATCTCACCGAAGTGGTCATCGCAG
CCCTGCTGAATGGCACACCCATCAACCCACTGCATCCGGACTTCGATGCG
GAAACCACGGCCTATATGTTCGAGATCACGAAGCCCAAGGTGATATTCTG
CGACCTGGACAACTACCAGACCTTGAGCGCGGTCAAAAGCAGTCTCAAGT
TCAAGACGGAGATCATTCTGCTCACTGGAACTCTGCCTGGAGTGCGTAAC
ATTCAGGATTTGCTTGCAGATGGCTGCACTGGATACGATGAGAAAACACT
CTTTGCCTGCCCGCATTTGTGTGGCGATGATACGGCCTTCATCATCACCT
CCTCGGGTGTAACCGGTTTGCCAAAGGGCGTAACCCGTTCGCATCGCAGT
CTGCTGAACAGTGCCAAAATCCCTCAGCTCTTTACCTCGGATACAGTGCT
GTTCTGCTTCAGTCCGCTCTATTGGATCAGCTGTATCTTCACACTGCTCG
CTTCGCTGGTCAATGGATGTCGCAGATCATCACCAATCGTCCTTTCAGCG
TGGCGTACTTTGCAGACCTTGTGGAACGACACCAGGTCAGCTTTGTGCTC
ACAGTGCCCCACCACATGGCTCTGCTGGCCAAGAGCCCAGAGAGACAGGA
GCTAGCAGCCAAGATGCAGTGTGTTCAGTCCTTCGTGTGCAGTGGCTCGA
AGGTACCGATGGGGATCTGCCGGCAGTTGTACGAGCTACTGGGTGGCGAA
CAAATTCCCCGTGCTTCTCCGGTCTCCCAGAGACCCGGAGGATCCTCAGA
ATGTGGGAGTCCACTGGGCAGCTAGGCCAGTTGCTGCAATTGTTCAAGTT
CCGTGTTA

FMO10161.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:59
Subject Length Description Subject Range Query Range Score Percent Strand
CG9993-RA 1802 CG9993-RA 78..1173 9..1101 5085 98 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:57
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 20851706..20852048 351..9 1715 100 Minus
2R 25286936 2R 20850798..20851208 1080..671 1605 95.4 Minus
2R 25286936 2R 20851449..20851648 550..351 1000 100 Minus
2R 25286936 2R 20851267..20851386 670..551 600 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:53:58 has no hits.

FMO10161.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:01 Download gff for FMO10161.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9993-RA 67..1061 1..995 99 == Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:48 Download gff for FMO10161.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9993-RA 71..1065 1..995 99 == Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:09 Download gff for FMO10161.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9993-RA 71..1065 1..995 99 == Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:09 Download gff for FMO10161.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 20851706..20852054 1..351 98   Minus
2R 20851449..20851647 352..550 100 <- Minus
2R 20851267..20851386 551..670 100 <- Minus
2R 20850883..20851208 671..995 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:48 Download gff for FMO10161.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16739211..16739559 1..351 98   Minus
arm_2R 16738954..16739152 352..550 100 <- Minus
arm_2R 16738772..16738891 551..670 100 <- Minus
arm_2R 16738388..16738713 671..995 99 <- Minus