Clone FMO10162 Report

Search the DGRC for FMO10162

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:62
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15629-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10162.5prime Sequence

1003 bp (1003 high quality bases) assembled on 2010-11-05

> FMO10162.5prime
CAGTCGACATGACCGCCTCACCGGGTCTTCTGCACATGGATCAACCGCTC
AGAGCCATCTATCAATTCTTACTCGACTTGCTAGTGTTTACGATTAAATC
GGTGTACTACGTACTCGAATCGATTTACTACAGTCTGTTGCCGCAGCGCT
TTCGAAAGTTAAAGGACATCTCCGGCCAGGTGGTGCTCATCACAGGAGGA
GGCGGTGGTGTTGGACGTTTGATTGCCCTAAACTTTGCTCGCCTTCAGGC
CCGCATTGTCATCTGGGATATAAATCAAGAAGCCATAAAGACAACTGTGG
ATTTGTTGGCCAAACATGGTTATGACAACTGCAAGGGCTACGTTGTGGAC
ATCTCAGATCGGGAGCAGATCTACCAGCGTGCCAGCCAGGTGACCGAGGA
GGTTGGTCCCGTCGACATATTGATTAACAATGCCGGTATCGTGTGCTGCA
AACCCTTCTGGGAGCTGCACGATCGGGTCATCCAGAACACGTACAACATT
AACATCATATCGCACTACTGGACCGTGAAAGCGTTTCTGCCTCACATGAT
GCGCAATAATCGTGGTCATATCGTTACTGTGGGCTCGGTAACTGGAATGC
TGGGCACCTACGGATGCAGTGACTACGCGGCCACCAAATACGCCTGCATC
GGTTTCCACGAGAGTTTGCTCACCGATCTGAAGGCCCATGGCTATGATCA
AATCCAAATGAGTTTGATCTGCCCGTACTACATCAACACGGGCATGTTTT
CGGGTGTTCGGCCGCGGATGATGCCCATGCTGGAGCCGCAGTATGTGGCG
GATCGCATCGAGAACGCCGTGCGCTGCAACGAGGTGTGGTGCGTGCTGCC
CAACTCTATTCGCCTGCTCACTCCTCTCAATGTCTTTTGCCCGCCAAATG
TGCTGGGAGCTGATGTCGCGTGTCATCCGTGGACCCGAGTCTATGATGAT
GGTTTCAGGGACGAGGGCGCGTCGCCGCTGGTGCAAGCTTTCTAGACCAT
TCG

FMO10162.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:02
Subject Length Description Subject Range Query Range Score Percent Strand
CG15629-RA 1432 CG15629-RA 345..1320 8..982 4810 99.7 Plus
CG3225-RA 2387 CG3225-RA 2221..2321 982..882 460 98 Minus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:00
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 4815021..4815620 281..880 3000 100 Plus
2L 23513712 2L 4813353..4813510 8..165 790 100 Plus
2L 23513712 2L 4814768..4814887 163..282 600 100 Plus
2L 23513712 2L 4815679..4815779 882..982 410 98 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:01 has no hits.

FMO10162.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:02 Download gff for FMO10162.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15629-RA 323..1307 1..986 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:50 Download gff for FMO10162.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15629-RA 339..1323 1..986 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:10 Download gff for FMO10162.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15629-RA 339..1323 1..986 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:10 Download gff for FMO10162.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 4815680..4815782 883..986 96   Plus
2L 4815023..4815623 283..882 99 -> Plus
2L 4814770..4814887 165..282 100 -> Plus
2L 4813347..4813509 1..164 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:50 Download gff for FMO10162.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 4815680..4815782 883..986 96   Plus
arm_2L 4815023..4815623 283..882 99 -> Plus
arm_2L 4814770..4814887 165..282 100 -> Plus
arm_2L 4813347..4813509 1..164 98 -> Plus