Clone FMO10164 Report

Search the DGRC for FMO10164

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:64
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpS11-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10164.5prime Sequence

491 bp (491 high quality bases) assembled on 2010-11-05

> FMO10164.5prime
CAGTCGACATGGCTGATCAGAACGAGCGCGCCTTCCAAAAACAATTCGGT
GTCAACCTAAACCGCAAGGTCAAGCCCGGTATCACCAAGAAGAAGCTGCT
GCGTCGCTCCCGCGATGTGGGACTCGGTTTCAAGACCCCACGTGAGGCCA
TCGATGGTACCTACATCGACAAGAAGTGCCCCTGGACCGGTGATGTGAGG
ATCCGTGGTCGCATTCTGACCGGCGTGGTCCGCAAGGCCAAGATGCAGCG
CACCATTGTCATTCGGCGCGACTACCTGCACTTTGTGCGCAAATACAGCC
GTTTCGAGAAGCGTCACCGCAACATGAGCGTCCACTGCTCCCCTGTGTTC
AGAGATGTTGAGCATGGCGATATTGTCACCATTGGTGAGTGCCGTCCTCT
GTCCAAGACTGTGCGCTTCAACGTCCTGAAAGTCAGCAAGGGTCAGGGAG
CCAAGAAGAGCTTCAAGAAGTACGCAAGCTTTCTAGACCAT

FMO10164.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:06
Subject Length Description Subject Range Query Range Score Percent Strand
RpS11-RC 738 CG8857-RC 28..494 7..473 2335 100 Plus
RpS11-RB 569 CG8857-RB 162..491 144..473 1650 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:04
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12199834..12200041 352..145 1040 100 Minus
2R 25286936 2R 12200115..12200244 147..18 650 100 Minus
2R 25286936 2R 12199469..12199592 473..350 620 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:54:05 has no hits.

FMO10164.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:02 Download gff for FMO10164.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS11-RA 36..513 1..479 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:51 Download gff for FMO10164.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS11-RC 23..500 1..479 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:13 Download gff for FMO10164.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS11-RC 23..500 1..479 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:13 Download gff for FMO10164.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12200116..12200249 13..146 98   Minus
2R 12199834..12200039 147..352 100 <- Minus
2R 12199463..12199589 353..479 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:51 Download gff for FMO10164.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8087621..8087754 13..146 98   Minus
arm_2R 8087339..8087544 147..352 100 <- Minus
arm_2R 8086968..8087094 353..479 97 <- Minus