Clone FMO10165 Report

Search the DGRC for FMO10165

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:65
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG14277-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10165.5prime Sequence

533 bp (533 high quality bases) assembled on 2010-11-05

> FMO10165.5prime
CAGTCGACATGTTGCGTCTGATTTGCGTGTTCCTGCTCAGCTGCGTTGGC
TTCCAGGCAGCCTTGGCTTGCAATGGCTACAAAGCCAAGCTGGTCAAGTT
GGAGAACTGTGCCGGCGAGGATGCCATTATGACGGTGGGCAGTGACTTCA
GCCTGAAGCTAAACAAGAAGTGTGAACTGGTACCCTCGGGCTGCATCATG
AACAAGCCGTTCAGTACCGCGGTGGCTAAGTTCAAGGTCCAGAAGGATGG
CATCGTAATGAAGGAGGGCAAGATCGATCTATGCGCCGCCATTGATCAGG
CCTCCTCCGAAGGTAAGGACATGCTAAAGCTTTTCGGAGCACCTTCCTCC
TGTCCGGTGGGCGAGGAGAAGGTGTGCGCCAACGATCACTCCGTGGATCT
GAGCAAGTACAAGGCCATGTTGGGCATGGCTCGTGGTCACCTCATCATCG
ATTCTGAGGTCAAGCATGACACGGGCAAGTCCTGCATTCATGCCGAAATC
GAGATCACCAAGAACGCAAGCTTTCTAGACCAT

FMO10165.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:09
Subject Length Description Subject Range Query Range Score Percent Strand
CG14277-RB 825 CG14277-RB 182..688 9..515 2535 100 Plus
CG14277-RA 679 CG14277-RA 36..542 9..515 2535 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:07
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 8242783..8243185 72..474 2015 100 Plus
2L 23513712 2L 8242667..8242729 9..71 315 100 Plus
2L 23513712 2L 8243247..8243289 473..515 215 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:08 has no hits.

FMO10165.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:03 Download gff for FMO10165.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14277-RA 1..507 9..515 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:54 Download gff for FMO10165.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14277-RA 32..542 1..515 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:14 Download gff for FMO10165.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14277-RA 32..542 1..515 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:14 Download gff for FMO10165.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 8243248..8243289 474..515 100   Plus
2L 8242783..8243184 72..473 100 -> Plus
2L 8242663..8242729 1..71 94 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:54 Download gff for FMO10165.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 8243248..8243289 474..515 100   Plus
arm_2L 8242783..8243184 72..473 100 -> Plus
arm_2L 8242663..8242729 1..71 94 -> Plus