Clone FMO10166 Report

Search the DGRC for FMO10166

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:66
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG31789-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10166.5prime Sequence

377 bp (377 high quality bases) assembled on 2010-11-05

> FMO10166.5prime
CAGTCGACATGAAGGCCTTGCAATTCGCTCTTGTATTTTCGGCCATTCTG
GCCATTGCCTTCGCTGCAAATGCCAGTTGGGGAGCCAAATTGTCCAGCAG
TAAGTTGGTCAGCACTCAGAACGTGACCATCTACAAGAAGGCCAACCAAT
ATGTGAGCAGTCTCATCAGTTTCCCACTGGCGGGCCAGAGCAACACTAAA
ACCATTCGGTACATTAGCATAACTGATAGGTTTACCAACAGTTCGGGACC
TTACTCCACCTTGTGGTCCGGTGGACCAGGATTCATCAATGCCCAGGTCA
ATGTCACAAGCCAGTTTTCTCAAGGAATCAATGTAACTGCTCAATTTTGG
GTGGATGCCGCAAGCTTTCTAGACCAT

FMO10166.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:12
Subject Length Description Subject Range Query Range Score Percent Strand
CG31789-RC 695 CG31789-RC 15..365 9..359 1755 100 Plus
CG31789-RB 472 CG31789-RB 15..365 9..359 1755 100 Plus
CG31789-RA 534 CG31789-RA 15..365 9..359 1755 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:10
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 18606177..18606354 182..359 890 100 Plus
2L 23513712 2L 18605942..18606116 9..183 875 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:11 has no hits.

FMO10166.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:04 Download gff for FMO10166.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31789-RA 1..358 9..366 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:55 Download gff for FMO10166.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31789-RA 15..372 9..366 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:15 Download gff for FMO10166.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31789-RA 15..372 9..366 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:15 Download gff for FMO10166.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 18606178..18606361 183..366 98   Plus
2L 18605942..18606115 9..182 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:55 Download gff for FMO10166.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 18606178..18606361 183..366 98   Plus
arm_2L 18605942..18606115 9..182 100 -> Plus