Clone FMO10168 Report

Search the DGRC for FMO10168

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:68
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCdk8-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10168.5prime Sequence

1137 bp (1028 high quality bases) assembled on 2010-11-05

> FMO10168.5prime
CAGTCGACATGGACTACGATTTCAAGATGAAAACGCAGATAGAGCGTACG
AAAGTGGAGGACCTATTCAACTACGAGGGCTGTAAGGTGGGACGCGGAAC
ATACGGCCACGTCTACAAGGCGAAATGGAAGGAGACAAGCGATGGCAAAG
AATATGCCTTGAAGCAGATCGACGGCACCGGATTGTCCATGTCCGCCTGC
CGCGAGATCGCATTGCTGCGCGAACTGAAGCATCAGAACGTAATTACCCT
CATCCGGGTGTTTCTGTCGCACAACGACCGCAAGGTGTTCCTGTTGATCG
ACTATGCGGAGCACGACCTGTGGCACATCATTAAGTTCCATCGGGCTGCT
AAGGCCACCAAAAAGCAGGTTGTGGTTCCCCGCGGTATGGTTAAAAGTCT
GCTATATCAGATTCTGGATGGGATTCACTATCTGCACAGTAATTGGGTGC
TACATCGTGACCTGAAGCCGGCCAACATCCTGGTGATGGGCGATGGCAAC
GAGAGGGGCCGCGTAAAAATCGCCGACATGGGTTTCGCGCGGCTCTTCAA
TGCCCCATTGAAACCGCTGGCAGATCTGGATCCCGTGGTGGTTACCTTTT
GGTATCGCGCTCCGGAACTGCTGCTTGGCGCTCGTCACTACACCAAGGCT
ATCGACATCTGGGCTATTGGCTGTATTTTCGCCGAACTACTCACTTCGGA
GCCCATCTTCCATTGCCGCCAGGAGGACATAAAGACCAGTAATCCGTACC
ATCACGATCAGCTAGACCGCATCTTCAATGTGATGGGCTTTCCGCAGGAC
AAGGACTGGGAGGATATCAAGAAGATGCCGGACATCATACGCTGACAAAG
GACTTTAACGCTCCACATACTCCACCTGCTCGCTGGCCAATACATGGAAG
GCACAAATAAGCCAGACAGCAAGGCCTTTCACCTGCTGCAGAAGCTGCTG
CTATGGATCCAACAAGCGCATCACCTCGAACAGGCCATGCAGGATCAGTA
CTTCCAGGAGGAGCCGCAGCCACGCAGGACTGTTCGCCGGCTGCCCATAC
CGTAATCCAAGCGTGAATTCCCTCCCGACGACGACAGAGATCGTCGATAA
TAGGGACGTGGCACAAGTGGAGGTAACATGCGTCAAC

FMO10168.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:19
Subject Length Description Subject Range Query Range Score Percent Strand
Cdk8-RA 1529 CG10572-RA 66..1154 9..1085 5070 98.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:17
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 9837455..9838414 1085..138 4145 98.1 Minus
3L 28110227 3L 9838475..9838605 139..9 655 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:54:18 has no hits.

FMO10168.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:05 Download gff for FMO10168.5prime
Subject Subject Range Query Range Percent Splice Strand
Cdk8-RA 40..1139 3..1090 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:58 Download gff for FMO10168.5prime
Subject Subject Range Query Range Percent Splice Strand
Cdk8-RA 81..1180 3..1090 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:18 Download gff for FMO10168.5prime
Subject Subject Range Query Range Percent Splice Strand
Cdk8-RA 60..1159 3..1090 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:18 Download gff for FMO10168.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 9838475..9838611 3..139 97   Minus
3L 9837470..9838412 140..1070 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:58 Download gff for FMO10168.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 9831575..9831711 3..139 97   Minus
arm_3L 9830570..9831512 140..1070 98 <- Minus