Clone FMO10169 Report

Search the DGRC for FMO10169

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:69
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15067-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10169.5prime Sequence

488 bp (488 high quality bases) assembled on 2010-11-05

> FMO10169.5prime
CAGTCGACATGAAGAGCCTGACGTTATTGGCGCTTTTGATCTTGGCCACG
TTGGCCTTTGTCCACGGTGGCAAGGTGACCATCAACGGCAAGTGCGTAAA
CTGCTCCCATGATCAAACGACTACCACCACGCACAAGCCAACAAGTGGAA
AAGGAAGTGGAGGTAGGACGACAGCCCGGCCAAGCTCGAGATCATCTCCA
GCCCGCGGTCGCCCATCATGGGATGACGATGATGATGATGACCTGACCGG
TGACTGGGCACTGCATCAATCGGCTGGAGGAACTCAATACATTGGCAGGC
GTTCGAAGCGTCAGTCACGCGGTGGTCAGTACATCGATTTGGGCGGATCT
GGCGGAAGGGGTGGAGGCGGAGGATGGGCAGGATCTGGCATAACCACCAT
CGATTCCAGTGGCTATCCCGGCGGAACACTGGTGCGCAATAGTGATTGCG
TCGGTTGCAATATTCGCGGAGCAAGCTTTCTAGACCAT

FMO10169.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:22
Subject Length Description Subject Range Query Range Score Percent Strand
CG15067-RB 505 CG15067-RB 19..480 9..470 2310 100 Plus
CG15067-RA 711 CG15067-RA 19..480 9..470 2310 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:20
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18385055..18385459 470..66 2025 100 Minus
2R 25286936 2R 18385512..18385571 68..9 300 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:54:21 has no hits.

FMO10169.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:05 Download gff for FMO10169.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15067-RA 14..484 1..475 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:00 Download gff for FMO10169.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15067-RA 15..485 1..475 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:21 Download gff for FMO10169.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15067-RA 15..485 1..475 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:21 Download gff for FMO10169.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 18385514..18385575 1..66 93   Minus
2R 18385050..18385458 67..475 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:00 Download gff for FMO10169.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14273019..14273080 1..66 93   Minus
arm_2R 14272555..14272963 67..475 99 <- Minus