Clone FMO10170 Report

Search the DGRC for FMO10170

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:70
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG16713-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10170.5prime Sequence

272 bp (272 high quality bases) assembled on 2010-11-05

> FMO10170.5prime
CAGTCGACATGAAACTGTTGATTTTGGTTTTCGTGTTTGTCGCTTTTGTG
GCCAACGCCTTGGCCCTGAAAAATGCAATCTGTGGTCTACCCCATTCCCT
AAACGGAGATGGCAGAATATCCTGTGAGGCCTATATACCCAGTTGGTCCT
ACGACGCCGATCGAAACGAGTGCGTCAAATTTATCTACGGAGGCTGCGGA
GGCAATAACAATAGATTTAATTCGAGGGAAATCTGTGAAGACAAGTGTTT
GCAAGCAAGCTTTCTAGACCAT

FMO10170.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:49
Subject Length Description Subject Range Query Range Score Percent Strand
CG16713-RA 325 CG16713-RA 56..301 9..254 1230 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:47
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 3695056..3695235 254..75 900 100 Minus
2L 23513712 2L 3695290..3695356 75..9 335 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:53:48 has no hits.

FMO10170.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:59 Download gff for FMO10170.5prime
Subject Subject Range Query Range Percent Splice Strand
CG16713-RA 51..303 9..262 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:42 Download gff for FMO10170.5prime
Subject Subject Range Query Range Percent Splice Strand
CG16713-RA 56..308 9..262 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:04 Download gff for FMO10170.5prime
Subject Subject Range Query Range Percent Splice Strand
CG16713-RA 56..308 9..262 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:04 Download gff for FMO10170.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 3695290..3695356 9..75 100   Minus
2L 3695057..3695234 76..253 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:42 Download gff for FMO10170.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 3695290..3695356 9..75 100   Minus
arm_2L 3695057..3695234 76..253 100 <- Minus