Clone FMO10171 Report

Search the DGRC for FMO10171

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:71
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpS11-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10171.5prime Sequence

488 bp (488 high quality bases) assembled on 2010-11-05

> FMO10171.5prime
CAGTCGACATGGCTGATCAGCAAACCGAACGCTCGTTCCGCAAGCAACAC
GCGGTGGTCGTTGTGCGTCGCAAGAGCCCCAACTTGAAGAAAAGGCCCCG
TTTCTATCGCCAAATTGGCCTGGGCTTCCGCGCTCCGGCGGAGGCCATCG
ATGGTACCTACATCGACAAGAAGTGCCCCTGGACCGGTGATGTGAGGATC
CGTGGTCGCATTCTGACCGGCGTGGTCCGCAAGGCCAAGATGCAGCGCAC
CATTGTCATTCGGCGCGACTACCTGCACTTTGTGCGCAAATACAGCCGTT
TCGAGAAGCGTCACCGCAACATGAGCGTCCACTGCTCCCCTGTGTTCAGA
GATGTTGAGCATGGCGATATTGTCACCATTGGTGAGTGCCGTCCTCTGTC
CAAGACTGTGCGCTTCAACGTCCTGAAAGTCAGCAAGGGTCAGGGAGCCA
AGAAGAGCTTCAAGAAGTACGCAAGCTTTCTAGACCAT

FMO10171.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:52
Subject Length Description Subject Range Query Range Score Percent Strand
RpS11-RB 569 CG8857-RB 28..491 7..470 2320 100 Plus
RpS11-RC 738 CG8857-RC 165..494 141..470 1650 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:50
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12199834..12200041 349..142 1040 100 Minus
2R 25286936 2R 12200427..12200553 144..18 635 100 Minus
2R 25286936 2R 12199469..12199592 470..347 620 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:53:51 has no hits.

FMO10171.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:00 Download gff for FMO10171.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS11-RB 36..510 1..476 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:44 Download gff for FMO10171.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS11-RB 23..497 1..476 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:06 Download gff for FMO10171.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS11-RB 23..497 1..476 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:06 Download gff for FMO10171.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12200428..12200555 14..143 98   Minus
2R 12199834..12200039 144..349 100 <- Minus
2R 12199463..12199589 350..476 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:44 Download gff for FMO10171.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8087933..8088060 14..143 98   Minus
arm_2R 8087339..8087544 144..349 100 <- Minus
arm_2R 8086968..8087094 350..476 97 <- Minus