Clone FMO10172 Report

Search the DGRC for FMO10172

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:72
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG17109-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10172.5prime Sequence

1174 bp (1043 high quality bases) assembled on 2010-11-05

> FMO10172.5prime
CAGTCGACATGAGTACCGAAAAGTGGGAGGACAACGAGGAAATCAAAATA
TTCCGCGAATATTTGCGCATAGCTACGGTGCAGCCAAATGTGGATTACAC
CGAATGTGTGGAGTTCCTGAAAAGGCAGGCTCACAGCCTGGATCTTCCCG
TGGATGTTATATATCCAGTGGAGAAGAAGCCTGTGGTGATCATCAAGTGG
TTGGGCACCGAACCGGAGCTGCCCTCCGTCATTCTCAACTCGCACATGGA
TGTGGTGCCGGTGTTCCGTGACAAGTGGACCCACGATCCCTTCGCTGCCG
ATATCGATGAGGAGGGCAGGATCTTTGCGCGCGGTACTCAGGACATGAAG
TCGGTGGGCACAGGATATCTGGGTGCCATCCGCCTGCTTAAGGCAAGTGG
TGTCCAGCCCAAGCGCAATTTCTTCGTGACCTTTGTGCCCGATGAGGAGA
TCGGCGGCGAGCTGGGCATGCAGGAGTTCGTCAAAACGGAATACTACAGC
AACATGAATGTTGGTTTCAGTCTGGACGAGGGCGGCACCAGTGAAATAGA
TCTGTTCTATGTCTTTTATGCCGAACGTATGCGATGGGGTCTCAAGCTGA
ATTTCAGTGGAACCTCTGGACACGGCTCCATGTTGCTGCCCAGCACTGCC
GGCGTGAAACTGAACTATGTGCTCAACAAGCTGACGGAGTTCCGCGAATC
GCAGGTTCAGAGGCTGGCCAATGATCAGACAATCAACATCGGTGATGTGA
CAACTATCAATCTCACCCAGCTGAGCGGTGGAGTCCAGAGCAATGTGGTG
CCTCCTCATTTCGAGGCTGTCTTCGACATGCGTCTGTCCATCACCCTGGA
TGTGGTTGCCTTTGAGAAACAGATCCACGATTGGTGCGAGGAGGCAGTGG
CGGCATCGAGATCTCCTTCGACGAGAAGAACCCTACGTGGCACCCACAAA
GATCGACGACTCCAATCCATTCTGGCTGGCTTTCAGCCTGCCACCGATGA
CTTGGCCTTAAGATCTTACCCATTGTCTGCCCCGGGTGCCACGACAGCAA
GAACATCGAGCTCAGGCATTCCAGCCTTGGGAATTCTCCACCCACTCAAT
ACCACATGCCCATCATGACTACCGAATGAGTCTTGGGCGGCGACCTATGT
GAGGCCATTCAATATACCAGAAAA

FMO10172.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:53:55
Subject Length Description Subject Range Query Range Score Percent Strand
CG17109-RB 1373 CG17109-RB 44..1220 9..1174 5175 97 Plus
CG17109-RA 1313 CG17109-RA 44..1220 9..1174 5175 97 Plus
CG6733-RA 1291 CG6733-RA 26..1013 3..985 1395 76.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:53:53
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23095883..23096373 100..590 2455 100 Plus
3R 32079331 3R 23096431..23096846 588..1000 1915 99 Plus
3R 32079331 3R 23097912..23098400 105..590 640 75.9 Plus
3R 32079331 3R 23098460..23098764 591..895 535 78.4 Plus
3R 32079331 3R 23095733..23095823 9..99 440 98.9 Plus
3R 32079331 3R 23099802..23100165 180..543 425 74.5 Plus
3R 32079331 3R 23100283..23100572 608..897 415 76.2 Plus
3R 32079331 3R 23092066..23092491 110..532 385 73.2 Plus
3R 32079331 3R 23092616..23092907 604..895 335 74.3 Plus
3R 32079331 3R 23091871..23091961 9..99 245 84.6 Plus
3R 32079331 3R 23093909..23094091 176..358 240 75.4 Plus
3R 32079331 3R 23096909..23096990 1003..1082 190 87.8 Plus
3R 32079331 3R 23097753..23097841 3..91 190 80.9 Plus
Blast to na_te.dros performed on 2014-11-26 16:53:54 has no hits.

FMO10172.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:01 Download gff for FMO10172.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17109-RA 35..1134 1..1099 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:09:47 Download gff for FMO10172.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17109-RA 38..1137 1..1099 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:07 Download gff for FMO10172.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17109-RA 38..1137 1..1099 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:07 Download gff for FMO10172.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 23096432..23096849 589..1002 98 -> Plus
3R 23095883..23096371 100..588 100 -> Plus
3R 23095727..23095823 1..99 94 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:09:47 Download gff for FMO10172.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 18922154..18922571 589..1002 98 -> Plus
arm_3R 18921605..18922093 100..588 100 -> Plus
arm_3R 18921449..18921545 1..99 94 -> Plus