Clone FMO10176 Report

Search the DGRC for FMO10176

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:76
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG3649-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10176.5prime Sequence

1113 bp (1010 high quality bases) assembled on 2010-11-05

> FMO10176.5prime
CAGTCGACATGACGATAAAATCGTTCAACTTGGTGGTAAAGGGTCCCATG
TGGGGCGTTCGCCACCTGCAGGTACTGTTCCTCTTTCTGTGCGCCACCTT
GATCGTGGCCCAGAGGTTCAACATGAGCGTGGCCATTGTGGCCTTTACGA
ATGCCAATAGCAGCAACCCAAATTATCCGGAATACCGACTGACAGAGCCT
CAGAAGTCGTACACCATCAGCAGTCCCTTCTGGGGCTCCTGCTGCACCCA
GATGATGAGTGGATACCTATCGAGTCGCTTTGGAGCCAAGGTGCTGCTGC
TGACCATCATGTTGCTCACCGCTCTGCTCAGCATTGCCACGCCCTTCGCC
TTGGCCTGGGGCGGCTGGCAGCTGCTCTTCTGGGTGCGATTCGTCCAGGG
ACTCGCCATGGGCGGCATGTGGCCCTGCCTGTACACCCATCTGGCCAAGT
GGTGTCCCAAGAAGGAGGCCAATCGCATGGGCGGCATCATGACCACTGGC
TTGGATTGTGGGACAATAATGGGATTCGCTTTGAGTGGCGTACTCTCTGC
ATCGCCCCTCGGGTGGCCCAGCACATTCTACGTGCCAGGATACTTAGGCA
TCGTGTGGTGCCTTACTTTCTTGCGATATGGCGCCAACAGCCCATCCGAA
TCGAAATTCATTTCTCTGGCGGAACGAAAGCACATTCAATTTGCCCTCGA
GCAGAATCAGGTGATTCGCGGTGCAACTCCTCCAGTACCGTGGCTCCAGA
TCCTCACCTCTCGTCCATTTATCGTCCTGGCGTTTTGCAAAATGAGCCAG
GCGTGCAGCTTCTACACGCTGATGCAACAGATTCCGCGCTACATCCACGG
TATATTCCACTACAGCATTGCGGCAAATGCCCTGCTCTCAGCTCTGCCCT
TTGTGGTCATGCTGATGTCATCCTACGGATTCATTTTCCTGGCTGAATAC
CTAACCCGGTCGTCGAGACATTTCATTGCCTATCCTACGGAAGAACATTA
ATTCCTTGGCCGCATGACCCCTGCTGTAGCCTGGTAATCTTATCCTACGT
CACGATCAGATGTGGTGGGCAGATGTTTTTGCTGGATGCACCACACTGCC
ATTTCGACAGCCA

FMO10176.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:41
Subject Length Description Subject Range Query Range Score Percent Strand
CG3649-RB 1569 CG3649-RB 41..1143 9..1105 5185 98.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:40
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 22846112..22846659 42..589 2740 100 Plus
2R 25286936 2R 22846910..22847399 586..1072 2130 98 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:40 has no hits.

FMO10176.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:09 Download gff for FMO10176.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3649-RA 1..1047 48..1090 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:12 Download gff for FMO10176.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3649-RB 34..1126 1..1090 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:30 Download gff for FMO10176.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3649-RB 34..1126 1..1090 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:30 Download gff for FMO10176.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 22846913..22847418 589..1090 97   Plus
2R 22846113..22846658 43..588 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:12 Download gff for FMO10176.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 18734436..18734941 589..1090 97   Plus
arm_2R 18733636..18734181 43..588 100 -> Plus