Clone FMO10177 Report

Search the DGRC for FMO10177

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:77
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPGRP-SB2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10177.5prime Sequence

572 bp (572 high quality bases) assembled on 2010-11-05

> FMO10177.5prime
CAGTCGACATGAAGCTACAGTTGGCTCTCGTTCTATGTGGATTGACTCTG
GCCTTGGGCCAGATTGTTCCCCGCAGCTCCTGGTGTCCTGTGCCCATCTC
GCCGCGAATGCCCAGGCTCATGGTACCGGTGCGACTGATTATCATCCATC
ATACAGTCACGGCCCCTTGCTTCAATCCGCATCAGTGCCAGTTGGTACTT
AGGCAAATTCGAGCCGATCATATGCGCAGAAAGTTCAGGGATATTGGCTA
TAATTTCCTGATCGGCGGGGATGGTCGAATCTACGAGGGCTTGGGTTTCG
GCATCCGTGGCGAGCATGCTCCCCGCTATAACAGCCAGTCCATTGGCATT
GCTTTCATTGGCAACTTCCAGACTGGATTACCTCCTTCGCAGATGCTCCA
GGCTGCCCGAACCCTCATCCAAATCGCTGTGCAGCGTCGCCAGGTTTCGC
CCAACTATTCCGTGGTGGGTCATTGCCAAACGAAGGCCACTGCTTGTCCG
GGAATACACCTTCTCAACGAGCTCAAAAAGTGGCCAAATTGGCGACCAAA
GCCTGCAAGCTTTCTAGACCAT

FMO10177.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:45
Subject Length Description Subject Range Query Range Score Percent Strand
PGRP-SB2-RA 688 CG9697-RA 6..553 7..554 2740 100 Plus
PGRP-SB2-RB 668 CG9697-RB 6..533 7..554 2430 96.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:43
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 16726546..16726911 7..372 1830 100 Plus
3L 28110227 3L 16726972..16727153 373..554 910 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:44 has no hits.

FMO10177.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:09 Download gff for FMO10177.5prime
Subject Subject Range Query Range Percent Splice Strand
PGRP-SB2-RA 1..556 2..555 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:14 Download gff for FMO10177.5prime
Subject Subject Range Query Range Percent Splice Strand
PGRP-SB2-RA 1..561 2..564 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:32 Download gff for FMO10177.5prime
Subject Subject Range Query Range Percent Splice Strand
PGRP-SB2-RA 1..561 2..564 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:32 Download gff for FMO10177.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 16726972..16727161 373..564 97   Plus
3L 16726540..16726911 1..372 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:14 Download gff for FMO10177.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 16720072..16720261 373..564 97   Plus
arm_3L 16719640..16720011 1..372 98 -> Plus