Clone FMO10180 Report

Search the DGRC for FMO10180

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:80
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG3566-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10180.5prime Sequence

377 bp (377 high quality bases) assembled on 2010-11-05

> FMO10180.5prime
CAGTCGACATGAGCAAGGAAATCCGTTTGGCCACCGTCAACGAACACAAC
AAAGCCACGGATCTGTGGGTGGTCATCGACAACAAGGTCTACGATGTGAC
CAAGTTCCGTCTCGAGCATCCCGGTGGCGAGGAATCCCTGGTGGATGAGG
CCGGTCGCGATGCCACCAAGGCCTTCAATGACGTGGGTCACAGCTCGGAG
GCGAGAGAGATGTTGAAGAAATACTACATTGGTGACCTGGCTGCTGCGGA
CATCAAGAAGAAAAGCCCAATTAGCTGCCGTCATGTGGCACTGGCCCTGG
GCGCCGCCTTCATCGGCATCTCGCTGGTCTATGTGATCCGACGCGGTGTG
GCCAGAAACGCAAGCTTTCTAGACCAT

FMO10180.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:55
Subject Length Description Subject Range Query Range Score Percent Strand
CG3566-RB 550 CG3566-RB 86..436 9..359 1755 100 Plus
CG3566-RD 770 CG3566-RD 86..351 9..274 1330 100 Plus
CG3566-RC 1607 CG3566-RC 86..351 9..274 1330 100 Plus
CG3566-RD 770 CG3566-RD 570..656 273..359 435 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:53
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 6276532..6276639 116..9 540 100 Minus
X 23542271 X 6276370..6276465 205..110 465 99 Minus
X 23542271 X 6275086..6275172 359..273 435 100 Minus
X 23542271 X 6276228..6276298 274..204 355 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:54:54 has no hits.

FMO10180.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:11 Download gff for FMO10180.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3566-RB 32..390 1..359 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:21 Download gff for FMO10180.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3566-RB 78..436 1..359 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:36 Download gff for FMO10180.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3566-RB 78..436 1..359 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:36 Download gff for FMO10180.5prime
Subject Subject Range Query Range Percent Splice Strand
X 6276532..6276647 1..116 97   Minus
X 6276370..6276458 117..205 100 <- Minus
X 6276228..6276296 206..274 100 <- Minus
X 6275086..6275170 275..359 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:21 Download gff for FMO10180.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 6170565..6170680 1..116 97   Minus
arm_X 6170403..6170491 117..205 100 <- Minus
arm_X 6170261..6170329 206..274 100 <- Minus
arm_X 6169119..6169203 275..359 100 <- Minus