Clone FMO10181 Report

Search the DGRC for FMO10181

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:81
Vector:pMK33-CFH-BD
Associated Gene/TranscriptVago-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10181.5prime Sequence

506 bp (506 high quality bases) assembled on 2010-11-05

> FMO10181.5prime
CAGTCGACATGGAGTCAATTAGCAGCATGATTTATTTAGTGGCCATGATG
TCATTGATCATCGGTGGCAGCCAAGCGATTCCTTATCGACCCTCGGCGTA
TCTGTACAATCAGCAGTACTGTATGGATACATTGACGGGTCGGCAGCTTT
ATATCGGTGAAGTCTTCACGCGAGAGGATCAGTGCGTCCGCATCCAATGC
CTGGAAACGCTGCAACTCTGGGAGGATAGCTGCCAGGTGCCGAAACTGAC
GCAGGGCAATTGCACGCCAGTTCCATCGACGAACCCGCATGCCGAATATC
CCCGATGCTGCCCACTGTATGAGTGCAAGAGCTACGAGTCGAATTCGGGG
GGAACTCTGGAGCAGACCAACATATATGACCACTATGGTACTCTGCGATC
ATCCCATCTCACTGAGATGATAGTGATCGACGGGCGGACACCCCCTCGTG
GCGAGATTCACACGGCGTCGGCGAGGAAGTATCAGGTGGCAAGCTTTCTA
GACCAT

FMO10181.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:58
Subject Length Description Subject Range Query Range Score Percent Strand
Vago-RD 796 CG2081-RD 82..561 9..488 2400 100 Plus
Vago-RB 684 CG2081-RB 82..561 9..488 2400 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:56
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 11089724..11089984 228..488 1305 100 Plus
X 23542271 X 11089521..11089659 91..229 695 100 Plus
X 23542271 X 11089371..11089452 9..90 410 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:57 has no hits.

FMO10181.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:12 Download gff for FMO10181.5prime
Subject Subject Range Query Range Percent Splice Strand
Vago-RB 77..561 1..488 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:23 Download gff for FMO10181.5prime
Subject Subject Range Query Range Percent Splice Strand
Vago-RB 77..561 1..488 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:39 Download gff for FMO10181.5prime
Subject Subject Range Query Range Percent Splice Strand
Vago-RB 77..561 1..488 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:39 Download gff for FMO10181.5prime
Subject Subject Range Query Range Percent Splice Strand
X 11089726..11089984 230..488 100   Plus
X 11089521..11089659 91..229 100 -> Plus
X 11089366..11089452 1..90 95 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:23 Download gff for FMO10181.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 10983759..10984017 230..488 100   Plus
arm_X 10983554..10983692 91..229 100 -> Plus
arm_X 10983399..10983485 1..90 95 -> Plus