Clone FMO10183 Report

Search the DGRC for FMO10183

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:83
Vector:pMK33-CFH-BD
Associated Gene/TranscriptEig71Eb-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10183.5prime Sequence

311 bp (311 high quality bases) assembled on 2010-11-05

> FMO10183.5prime
CAGTCGACATGTCCAAGATTACTCTGTTTATTGCTTTTATTTGCCTTTTC
GTTATCGTTCAGGCCCAAAGTGATAGAGATATTTGTAGACGGATTGTCGC
CAGATGTGAGTCAAGGGTCGTGAGAAATGGCAGAAACAACGATATTTCGA
ATATTTTCAATGAGAACTGTCGGCGAACACAAAGAAATTGGCGTGAAATC
TCCCGATGCGAACTCGCAAAAGCTAATTGTATATTGACCCTTGAGCGATG
TAACACGTTGTCCTGCGAGAATGTCCGGCGAGCCCTTGCACAAGCAAGCT
TTCTAGACCAT

FMO10183.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:28
Subject Length Description Subject Range Query Range Score Percent Strand
Eig71Eb-RB 425 CG7355-RB 49..333 9..293 1425 100 Plus
Eig71Eb-RA 472 CG7355-RA 49..333 9..293 1425 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:27
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 15650082..15650283 33..234 1010 100 Plus
3L 28110227 3L 15650344..15650402 235..293 295 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:28 has no hits.

FMO10183.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:06 Download gff for FMO10183.5prime
Subject Subject Range Query Range Percent Splice Strand
Eig71Eb-RA 16..311 1..297 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:03 Download gff for FMO10183.5prime
Subject Subject Range Query Range Percent Splice Strand
Eig71Eb-RA 41..336 1..297 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:23 Download gff for FMO10183.5prime
Subject Subject Range Query Range Percent Splice Strand
Eig71Eb-RA 41..336 1..297 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:23 Download gff for FMO10183.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 15650344..15650405 235..297 96   Plus
3L 15650083..15650283 34..234 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:03 Download gff for FMO10183.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 15643444..15643505 235..297 96   Plus
arm_3L 15643183..15643383 34..234 100 -> Plus