Clone FMO10184 Report

Search the DGRC for FMO10184

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:84
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG42288-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10184.5prime Sequence

506 bp (506 high quality bases) assembled on 2010-11-05

> FMO10184.5prime
CAGTCGACATGGCCTGTCGCTGCAAATATCTGAAGCAGATCTTTACCAAG
TGCTGCTACTGCTATTCCCTGCGTTTCGGTGTGCTGCTCTTCGGATGCAT
TTTTCTAACCTGGTTCATTTACATCACCATCGGCACCGGCTTCATGATGG
AGTGCATCTTTCCGAACGAGTATCAGAGGTCCCTTATCCCAGCACCGGCG
GCCCTCAAGGCCACCATGGTCTTCTCCTTCTTCGGCATCATAGTTTCGGC
CATGCTCTGCCTGGGAGTGCACAATAACAACGAGATGCTCTTCCTGCCAT
TTTTGGTTTTCACACCCATTTGGATAATTGTGCACATTTTTGCCCTGACC
GTTTACAGCTTTAATACCATCATCATCATCCTGACTGTCATCACAATGTT
ACTTTTAGTGTATGCCTGGCTGGTGGTTTGGTCCTACTACATAGAACTGC
TCTTCGCCTACGAAGATGAACTGGAAACCGGTTATGTGGCAAGCTTTCTA
GACCAT

FMO10184.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:31
Subject Length Description Subject Range Query Range Score Percent Strand
CG42288-RA 648 CG42288-RA 78..558 8..488 2405 100 Plus
CG42288-RB 639 CG42288-RB 78..549 8..488 2260 98.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:30
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 14091108..14091375 8..275 1340 100 Plus
2R 25286936 2R 14091448..14091571 276..399 620 100 Plus
2R 25286936 2R 14091636..14091724 400..488 445 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:30 has no hits.

FMO10184.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:07 Download gff for FMO10184.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42288-RA 69..561 1..492 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:06 Download gff for FMO10184.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42288-RA 69..561 1..492 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:25 Download gff for FMO10184.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42288-RA 69..561 1..492 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:25 Download gff for FMO10184.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 14091636..14091727 400..492 97   Plus
2R 14091448..14091571 276..399 100 -> Plus
2R 14091099..14091375 1..275 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:06 Download gff for FMO10184.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 9979141..9979232 400..492 97   Plus
arm_2R 9978953..9979076 276..399 100 -> Plus
arm_2R 9978604..9978880 1..275 98 -> Plus