Clone FMO10186 Report

Search the DGRC for FMO10186

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:86
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34454-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10186.5prime Sequence

425 bp (425 high quality bases) assembled on 2010-11-05

> FMO10186.5prime
CAGTCGACATGTGCATCAATTGGCATCCAATATTTATTTTTGCTTGTTTA
AGTCAGTTGGGCGCAGCCCAAGAACCTTTAATTTTCGAAACATCTCGTAG
CCCATGGAACAATGCCGCCGCAACGACGTCAATACCAATTTCGCCCACCA
GCGCAAACTTAGTTTTGGTTAACAATGTAAGAATACCAGGAGGTCTTACA
CCATTTGTACCAGCACCGGCCCCAACCAAGGAATTTCTGAACTGCTTTGG
TAACTGTCCCACCACATCGCAATACAATCCCATTTGCGGCAGCAATATGC
AGCTTTATATGAACGAGGAAAAATTTAATTGTGCTCGTTTCTGTGGAGCT
GACATTCAAATAGTTCGAAGAGGTTCTTGTGAGGGTCTTTTTGCGATGAC
GCGAGGTGCAAGCTTTCTAGACCAT

FMO10186.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG34454-RA 603 CG34454-RA 49..447 9..407 1995 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:07
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 231960..232302 351..9 1715 100 Minus
3L 28110227 3L 231837..231893 407..351 285 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:55:07 has no hits.

FMO10186.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:13 Download gff for FMO10186.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34454-RA 1..399 9..407 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:29 Download gff for FMO10186.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34454-RA 40..447 1..407 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:45 Download gff for FMO10186.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34454-RA 40..447 1..407 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:45 Download gff for FMO10186.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 231960..232311 1..351 98   Minus
3L 231837..231892 352..407 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:29 Download gff for FMO10186.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 231960..232311 1..351 98   Minus
arm_3L 231837..231892 352..407 100 <- Minus