Clone FMO10187 Report

Search the DGRC for FMO10187

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:87
Vector:pMK33-CFH-BD
Associated Gene/TranscriptFen1-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10187.5prime Sequence

1126 bp (966 high quality bases) assembled on 2010-11-05

> FMO10187.5prime
CAGTCGACATGGGAATTTTGGGCTTATCTAAGCTCATTGCCGATCTGGCG
CCACAGGCGATTCGCGAAAGTGAGATGAAGCATTTTTTCGGTCGCAAGGT
AGCAATCGATGCTAGTATGTGCCTGTACCAGTTCCTCATCGCCGTGCGCT
CCGAAGGCGCCCAGTTGGCCACCGTAAATGGTGATCCCACGTCCCACTTA
ATGGGCATGTTCTACCGCACCATCCGATTGCTGGACAACGGAATCAAGCC
GGTATATGTCTTCGACGGAAAGCCACCAGATCTCAAGTCCGGTGAGCTGG
CGAAGCGCGCCGAGCGGCGGGAGGAAGCGGAGAAGGCACTGAAGGCGGCC
ACCGATGCGGGAGATGATGCCGGTATCGAAAAGTTTAATCGCCGATTGGT
CCGGGTAACGAAGGAGCACGCCAAAGAGGCCAAGGAACTGCTCATATTAA
TGGGTGTGCCCTATGTTGATGCACCGTGCGAAGCGGAGGCCCAGTGTGCC
GCTCTGGTGAAAGCTGGAAAGGTTTATGCCACCGCCACGGAGGATATGGA
TGCCCTCACATTCGGATCTACAAAACTGTTGAGATACCTTACCTACAGCG
AGGCACGAAAGATGCCCGTCAAGGAGTTCAGCTACGACAAGCTGTTGGAA
GGTCTGGCCATTAACAATCGAGAGTTCATTGATCTATGTATTCTGCTGGG
TTGCGATTACTGTGAGAGCATCAAAGGGTATTGGACCCAAGCGAGCGATC
GAACTGATCAACACCTATCGGGATATAGAGACTATTCTGGATAACCTGGA
CTCTAGCAATACACCGTGCCCGAGAACTGGAACTACAAGGTGGCGCGGGA
CTCTTCATCGAACCGGAGGTAGCTGATGCCGACTCCATAGATCTCAATGG
GTCGAGCCGGATGAGAAGGCCCTTGTCAAGTTTCTCTGCGGCGACCGGCA
GTCAACGAAGAGCGCGTCTGCAACGGTGGCCAAAAGCTGATGAAATCCAA
GCAAGCCCAAACCTCAGTGAAGACTGAATAGCTTCTTTAAAAACCTGCCC
AGCACTTCAATGCCCTACGCTGCAAACGGAAGGCCAAGAAGCTAAGAAAA
GCTCCAATATACAAAAAGGCCAAAGA

FMO10187.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:11
Subject Length Description Subject Range Query Range Score Percent Strand
Fen1-RA 1378 CG8648-RA 122..1247 4..1123 4970 96.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:09
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 16854227..16855195 1056..90 4285 97.5 Minus
2R 25286936 2R 16855255..16855343 92..4 430 98.9 Minus
Blast to na_te.dros performed on 2014-11-26 16:55:10 has no hits.

FMO10187.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:14 Download gff for FMO10187.5prime
Subject Subject Range Query Range Percent Splice Strand
Fen1-RA 1..1122 9..1125 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:31 Download gff for FMO10187.5prime
Subject Subject Range Query Range Percent Splice Strand
Fen1-RA 119..1248 1..1125 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:47 Download gff for FMO10187.5prime
Subject Subject Range Query Range Percent Splice Strand
Fen1-RA 119..1248 1..1125 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:47 Download gff for FMO10187.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 16855257..16855344 1..90 96   Minus
2R 16854155..16855194 91..1125 96 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:31 Download gff for FMO10187.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 12742762..12742849 1..90 96   Minus
arm_2R 12741660..12742699 91..1125 96 <- Minus